\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0208149227:

Variant ID: vg0208149227 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 8149227
Reference Allele: CAlternative Allele: CATATTT,T
Primary Allele: CSecondary Allele: CATATTT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAAATGCACTCGGCTTGGTCTGAAATCGGGCATTTTTTAGATAATGGATATCACTCCGTCCTCTCCATTCTAATAGGTGTACTCCCTCCATACTCGTACT[C/CATATTT,T]
GTAAAGAAAGTCGTTTAGAATAGTGACACGGTCTCTAAAACACAATTTTGACTTCTTATTTCTATAAAAATATTTATTAAAAAGTGATATATATATATAC

Reverse complement sequence

GTATATATATATATCACTTTTTAATAAATATTTTTATAGAAATAAGAAGTCAAAATTGTGTTTTAGAGACCGTGTCACTATTCTAAACGACTTTCTTTAC[G/AAATATG,A]
AGTACGAGTATGGAGGGAGTACACCTATTAGAATGGAGAGGACGGAGTGATATCCATTATCTAAAAAATGCCCGATTTCAGACCAAGCCGAGTGCATTTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of CATATTT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.70% 7.40% 0.63% 0.00% T: 7.24%
All Indica  2759 84.90% 2.40% 1.09% 0.00% T: 11.60%
All Japonica  1512 98.70% 0.70% 0.00% 0.00% T: 0.53%
Aus  269 19.70% 77.70% 0.00% 0.00% T: 2.60%
Indica I  595 87.70% 0.20% 0.00% 0.00% T: 12.10%
Indica II  465 67.50% 1.10% 0.65% 0.00% T: 30.75%
Indica III  913 94.60% 3.50% 0.44% 0.00% T: 1.42%
Indica Intermediate  786 81.70% 3.70% 2.93% 0.00% T: 11.70%
Temperate Japonica  767 99.50% 0.00% 0.00% 0.00% T: 0.52%
Tropical Japonica  504 98.60% 1.20% 0.00% 0.00% T: 0.20%
Japonica Intermediate  241 96.70% 2.10% 0.00% 0.00% T: 1.24%
VI/Aromatic  96 44.80% 55.20% 0.00% 0.00% NA
Intermediate  90 78.90% 13.30% 0.00% 0.00% T: 7.78%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0208149227 C -> T LOC_Os02g14740.1 downstream_gene_variant ; 2165.0bp to feature; MODIFIER silent_mutation Average:91.674; most accessible tissue: Minghui63 flag leaf, score: 95.963 N N N N
vg0208149227 C -> T LOC_Os02g14730-LOC_Os02g14740 intergenic_region ; MODIFIER silent_mutation Average:91.674; most accessible tissue: Minghui63 flag leaf, score: 95.963 N N N N
vg0208149227 C -> CATATTT LOC_Os02g14740.1 downstream_gene_variant ; 2164.0bp to feature; MODIFIER silent_mutation Average:91.674; most accessible tissue: Minghui63 flag leaf, score: 95.963 N N N N
vg0208149227 C -> CATATTT LOC_Os02g14730-LOC_Os02g14740 intergenic_region ; MODIFIER silent_mutation Average:91.674; most accessible tissue: Minghui63 flag leaf, score: 95.963 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0208149227 C CATAT* -0.09 -0.2 -0.17 -0.11 -0.27 -0.35
vg0208149227 C T -0.01 -0.01 -0.02 -0.04 -0.03 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0208149227 NA 1.10E-06 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208149227 NA 4.24E-07 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208149227 NA 9.80E-06 mr1484 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208149227 NA 6.76E-08 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208149227 9.95E-06 9.95E-06 mr1762 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208149227 8.85E-06 NA mr1906 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208149227 NA 1.87E-06 mr1949 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208149227 NA 1.64E-08 mr1982 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251