\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0208099201:

Variant ID: vg0208099201 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 8099201
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.95, G: 0.04, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


TAATATTTTTTATTTCCAATTTCATTTGTTTCAAAATTTTATTCCTACTTGAACTCTCTATTTTATTTTTTTTCTAATTTTGGATTTTATTTGATTTTTT[A/G]
TTTTGAATTTAATTAATATCGTATTGGTCTCTTATATGGACTCTTTTTTCAATATTACTTATTTTTAATTTCGAATTTTATTTATTTTCAAATTGTATTC

Reverse complement sequence

GAATACAATTTGAAAATAAATAAAATTCGAAATTAAAAATAAGTAATATTGAAAAAAGAGTCCATATAAGAGACCAATACGATATTAATTAAATTCAAAA[T/C]
AAAAAATCAAATAAAATCCAAAATTAGAAAAAAAATAAAATAGAGAGTTCAAGTAGGAATAAAATTTTGAAACAAATGAAATTGGAAATAAAAAATATTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.50% 45.00% 0.47% 0.00% NA
All Indica  2759 36.20% 63.10% 0.69% 0.00% NA
All Japonica  1512 98.10% 1.90% 0.00% 0.00% NA
Aus  269 1.90% 98.10% 0.00% 0.00% NA
Indica I  595 33.40% 65.90% 0.67% 0.00% NA
Indica II  465 18.50% 80.00% 1.51% 0.00% NA
Indica III  913 50.50% 49.10% 0.44% 0.00% NA
Indica Intermediate  786 32.10% 67.40% 0.51% 0.00% NA
Temperate Japonica  767 98.60% 1.40% 0.00% 0.00% NA
Tropical Japonica  504 98.20% 1.80% 0.00% 0.00% NA
Japonica Intermediate  241 96.70% 3.30% 0.00% 0.00% NA
VI/Aromatic  96 43.80% 56.20% 0.00% 0.00% NA
Intermediate  90 53.30% 43.30% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0208099201 A -> G LOC_Os02g14680-LOC_Os02g14700 intergenic_region ; MODIFIER silent_mutation Average:15.428; most accessible tissue: Callus, score: 22.215 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0208099201 8.08E-07 4.13E-08 mr1171 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208099201 NA 3.70E-06 mr1171 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208099201 NA 2.38E-06 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208099201 NA 4.54E-06 mr1416 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208099201 NA 2.39E-06 mr1448 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208099201 NA 6.06E-07 mr1516 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208099201 NA 3.85E-20 mr1557 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208099201 NA 2.05E-11 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208099201 NA 4.96E-07 mr1781 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251