\
| Variant ID: vg0208099201 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 8099201 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.95, G: 0.04, others allele: 0.00, population size: 122. )
TAATATTTTTTATTTCCAATTTCATTTGTTTCAAAATTTTATTCCTACTTGAACTCTCTATTTTATTTTTTTTCTAATTTTGGATTTTATTTGATTTTTT[A/G]
TTTTGAATTTAATTAATATCGTATTGGTCTCTTATATGGACTCTTTTTTCAATATTACTTATTTTTAATTTCGAATTTTATTTATTTTCAAATTGTATTC
GAATACAATTTGAAAATAAATAAAATTCGAAATTAAAAATAAGTAATATTGAAAAAAGAGTCCATATAAGAGACCAATACGATATTAATTAAATTCAAAA[T/C]
AAAAAATCAAATAAAATCCAAAATTAGAAAAAAAATAAAATAGAGAGTTCAAGTAGGAATAAAATTTTGAAACAAATGAAATTGGAAATAAAAAATATTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.50% | 45.00% | 0.47% | 0.00% | NA |
| All Indica | 2759 | 36.20% | 63.10% | 0.69% | 0.00% | NA |
| All Japonica | 1512 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 1.90% | 98.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 33.40% | 65.90% | 0.67% | 0.00% | NA |
| Indica II | 465 | 18.50% | 80.00% | 1.51% | 0.00% | NA |
| Indica III | 913 | 50.50% | 49.10% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 32.10% | 67.40% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 43.80% | 56.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 53.30% | 43.30% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0208099201 | A -> G | LOC_Os02g14680-LOC_Os02g14700 | intergenic_region ; MODIFIER | silent_mutation | Average:15.428; most accessible tissue: Callus, score: 22.215 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0208099201 | 8.08E-07 | 4.13E-08 | mr1171 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208099201 | NA | 3.70E-06 | mr1171 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208099201 | NA | 2.38E-06 | mr1392 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208099201 | NA | 4.54E-06 | mr1416 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208099201 | NA | 2.39E-06 | mr1448 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208099201 | NA | 6.06E-07 | mr1516 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208099201 | NA | 3.85E-20 | mr1557 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208099201 | NA | 2.05E-11 | mr1730 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0208099201 | NA | 4.96E-07 | mr1781 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |