Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0207925710:

Variant ID: vg0207925710 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 7925710
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 27. )

Flanking Sequence (100 bp) in Reference Genome:

TCTACAAACAATAACAAAGTTTATGCTTCTCTGCTGCCATGAAAATATTGTGATTATATTATTCTACTATTTACCATTGATGAACACAAGTTCTACGTAT[T/A]
TACAATCATACTTCTCTTTCTCCCACATTTTATTTTTTTTTCAAACCAAGGGAGGCTCCCACGATATATATTAATTTCTGAAGTTTATATAAAAATAATG

Reverse complement sequence

CATTATTTTTATATAAACTTCAGAAATTAATATATATCGTGGGAGCCTCCCTTGGTTTGAAAAAAAAATAAAATGTGGGAGAAAGAGAAGTATGATTGTA[A/T]
ATACGTAGAACTTGTGTTCATCAATGGTAAATAGTAGAATAATATAATCACAATATTTTCATGGCAGCAGAGAAGCATAAACTTTGTTATTGTTTGTAGA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.40%	39.10%	0.40%	4.08%	NA
All Indica	2759	92.40%	6.40%	0.11%	1.12%	NA
All Japonica	1512	2.50%	97.40%	0.07%	0.07%	NA
Aus	269	13.00%	37.20%	3.35%	46.47%	NA
Indica I	595	97.60%	2.20%	0.00%	0.17%	NA
Indica II	465	94.40%	4.70%	0.22%	0.65%	NA
Indica III	913	89.20%	9.20%	0.11%	1.53%	NA
Indica Intermediate	786	90.80%	7.40%	0.13%	1.65%	NA
Temperate Japonica	767	1.70%	98.30%	0.00%	0.00%	NA
Tropical Japonica	504	4.20%	95.80%	0.00%	0.00%	NA
Japonica Intermediate	241	1.70%	97.50%	0.41%	0.41%	NA
VI/Aromatic	96	5.20%	59.40%	4.17%	31.25%	NA
Intermediate	90	45.60%	45.60%	2.22%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0207925710	T -> A	LOC_Os02g14420.1	downstream_gene_variant ; 2755.0bp to feature; MODIFIER	silent_mutation	Average:33.971; most accessible tissue: Minghui63 young leaf, score: 76.82	N	N	N	N
vg0207925710	T -> A	LOC_Os02g14420-LOC_Os02g14430	intergenic_region ; MODIFIER	silent_mutation	Average:33.971; most accessible tissue: Minghui63 young leaf, score: 76.82	N	N	N	N
vg0207925710	T -> DEL	N	N	silent_mutation	Average:33.971; most accessible tissue: Minghui63 young leaf, score: 76.82	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0207925710	NA	1.31E-09	mr1047	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207925710	NA	7.74E-06	mr1189	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207925710	NA	1.43E-12	mr1326	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207925710	NA	5.37E-12	mr1657	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207925710	NA	1.04E-28	mr1793	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207925710	NA	3.75E-07	mr1796	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207925710	NA	8.88E-12	mr1914	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207925710	NA	7.79E-07	mr1990	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207925710	NA	1.19E-09	mr1322_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207925710	NA	1.67E-15	mr1325_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207925710	NA	1.18E-16	mr1326_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207925710	NA	1.97E-44	mr1509_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207925710	NA	1.16E-07	mr1527_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207925710	NA	2.51E-07	mr1623_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207925710	NA	1.35E-08	mr1690_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207925710	NA	5.35E-11	mr1734_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207925710	NA	3.50E-17	mr1744_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207925710	NA	5.56E-10	mr1782_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251