\
| Variant ID: vg0207900353 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 7900353 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GGCCGCCTGTCCTCATCATGGGATGGACGACTAGCTGATCCTAGAGAATTTTTACAATTGTCTCACCCCAATGTCCCGTGATCACCTGGACGCGGTAGCT[G/A]
GAGGAGCTTTCTTCTCTAAAACGGTTCAAGGAGCCGTTGAACTCATAGAGAAGATGGTCTCCAATATGGGTTGGAGCGAAGAACGACTCCAAACCTGTTA
TAACAGGTTTGGAGTCGTTCTTCGCTCCAACCCATATTGGAGACCATCTTCTCTATGAGTTCAACGGCTCCTTGAACCGTTTTAGAGAAGAAAGCTCCTC[C/T]
AGCTACCGCGTCCAGGTGATCACGGGACATTGGGGTGAGACAATTGTAAAAATTCTCTAGGATCAGCTAGTCGTCCATCCCATGATGAGGACAGGCGGCC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.80% | 36.40% | 1.61% | 6.24% | NA |
| All Indica | 2759 | 91.00% | 5.90% | 0.65% | 2.39% | NA |
| All Japonica | 1512 | 2.60% | 97.30% | 0.07% | 0.07% | NA |
| Aus | 269 | 14.10% | 3.00% | 7.43% | 75.46% | NA |
| Indica I | 595 | 98.00% | 1.30% | 0.34% | 0.34% | NA |
| Indica II | 465 | 89.00% | 3.70% | 2.15% | 5.16% | NA |
| Indica III | 913 | 89.20% | 8.90% | 0.44% | 1.53% | NA |
| Indica Intermediate | 786 | 89.20% | 7.30% | 0.25% | 3.31% | NA |
| Temperate Japonica | 767 | 1.70% | 98.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 4.20% | 95.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.10% | 97.10% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 6.20% | 41.70% | 33.33% | 18.75% | NA |
| Intermediate | 90 | 45.60% | 41.10% | 5.56% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0207900353 | G -> A | LOC_Os02g14390.1 | upstream_gene_variant ; 108.0bp to feature; MODIFIER | silent_mutation | Average:25.605; most accessible tissue: Zhenshan97 flag leaf, score: 70.837 | N | N | N | N |
| vg0207900353 | G -> A | LOC_Os02g14380.1 | downstream_gene_variant ; 67.0bp to feature; MODIFIER | silent_mutation | Average:25.605; most accessible tissue: Zhenshan97 flag leaf, score: 70.837 | N | N | N | N |
| vg0207900353 | G -> A | LOC_Os02g14380-LOC_Os02g14390 | intergenic_region ; MODIFIER | silent_mutation | Average:25.605; most accessible tissue: Zhenshan97 flag leaf, score: 70.837 | N | N | N | N |
| vg0207900353 | G -> DEL | N | N | silent_mutation | Average:25.605; most accessible tissue: Zhenshan97 flag leaf, score: 70.837 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0207900353 | NA | 1.70E-10 | mr1322_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207900353 | NA | 7.11E-16 | mr1324_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207900353 | NA | 3.54E-15 | mr1325_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207900353 | NA | 2.19E-17 | mr1326_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207900353 | NA | 1.72E-15 | mr1333_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207900353 | NA | 1.29E-09 | mr1379_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207900353 | NA | 1.29E-07 | mr1527_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207900353 | NA | 5.49E-07 | mr1559_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207900353 | NA | 5.03E-07 | mr1623_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207900353 | NA | 7.02E-09 | mr1690_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207900353 | NA | 1.02E-17 | mr1744_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |