\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0207900353:

Variant ID: vg0207900353 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 7900353
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGCCGCCTGTCCTCATCATGGGATGGACGACTAGCTGATCCTAGAGAATTTTTACAATTGTCTCACCCCAATGTCCCGTGATCACCTGGACGCGGTAGCT[G/A]
GAGGAGCTTTCTTCTCTAAAACGGTTCAAGGAGCCGTTGAACTCATAGAGAAGATGGTCTCCAATATGGGTTGGAGCGAAGAACGACTCCAAACCTGTTA

Reverse complement sequence

TAACAGGTTTGGAGTCGTTCTTCGCTCCAACCCATATTGGAGACCATCTTCTCTATGAGTTCAACGGCTCCTTGAACCGTTTTAGAGAAGAAAGCTCCTC[C/T]
AGCTACCGCGTCCAGGTGATCACGGGACATTGGGGTGAGACAATTGTAAAAATTCTCTAGGATCAGCTAGTCGTCCATCCCATGATGAGGACAGGCGGCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.80% 36.40% 1.61% 6.24% NA
All Indica  2759 91.00% 5.90% 0.65% 2.39% NA
All Japonica  1512 2.60% 97.30% 0.07% 0.07% NA
Aus  269 14.10% 3.00% 7.43% 75.46% NA
Indica I  595 98.00% 1.30% 0.34% 0.34% NA
Indica II  465 89.00% 3.70% 2.15% 5.16% NA
Indica III  913 89.20% 8.90% 0.44% 1.53% NA
Indica Intermediate  786 89.20% 7.30% 0.25% 3.31% NA
Temperate Japonica  767 1.70% 98.30% 0.00% 0.00% NA
Tropical Japonica  504 4.20% 95.80% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.10% 0.41% 0.41% NA
VI/Aromatic  96 6.20% 41.70% 33.33% 18.75% NA
Intermediate  90 45.60% 41.10% 5.56% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0207900353 G -> A LOC_Os02g14390.1 upstream_gene_variant ; 108.0bp to feature; MODIFIER silent_mutation Average:25.605; most accessible tissue: Zhenshan97 flag leaf, score: 70.837 N N N N
vg0207900353 G -> A LOC_Os02g14380.1 downstream_gene_variant ; 67.0bp to feature; MODIFIER silent_mutation Average:25.605; most accessible tissue: Zhenshan97 flag leaf, score: 70.837 N N N N
vg0207900353 G -> A LOC_Os02g14380-LOC_Os02g14390 intergenic_region ; MODIFIER silent_mutation Average:25.605; most accessible tissue: Zhenshan97 flag leaf, score: 70.837 N N N N
vg0207900353 G -> DEL N N silent_mutation Average:25.605; most accessible tissue: Zhenshan97 flag leaf, score: 70.837 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0207900353 NA 1.70E-10 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207900353 NA 7.11E-16 mr1324_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207900353 NA 3.54E-15 mr1325_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207900353 NA 2.19E-17 mr1326_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207900353 NA 1.72E-15 mr1333_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207900353 NA 1.29E-09 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207900353 NA 1.29E-07 mr1527_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207900353 NA 5.49E-07 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207900353 NA 5.03E-07 mr1623_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207900353 NA 7.02E-09 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207900353 NA 1.02E-17 mr1744_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251