\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0207897910:

Variant ID: vg0207897910 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 7897910
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCACCCAGATCAAGACCAGTCCTATAAATCTCAAATAATAACAAGAAACAACCAAATGCTGGAAAAAATGGAAAAATATTTGACCCATAAATCTGAAACA[A/G]
TGCTGGCCCAGTTTTAGAGGGCTATCGGTATTTCCAATACAAAGTCCAGCTATGTTGGCTTTACAGGGAACAAGTCCGAACGTAAATTATGCAGTTAACC

Reverse complement sequence

GGTTAACTGCATAATTTACGTTCGGACTTGTTCCCTGTAAAGCCAACATAGCTGGACTTTGTATTGGAAATACCGATAGCCCTCTAAAACTGGGCCAGCA[T/C]
TGTTTCAGATTTATGGGTCAAATATTTTTCCATTTTTTCCAGCATTTGGTTGTTTCTTGTTATTATTTGAGATTTATAGGACTGGTCTTGATCTGGGTGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.00% 36.00% 0.08% 7.93% NA
All Indica  2759 91.30% 5.50% 0.04% 3.15% NA
All Japonica  1512 2.60% 97.20% 0.00% 0.13% NA
Aus  269 14.10% 1.90% 0.37% 83.64% NA
Indica I  595 98.30% 1.00% 0.00% 0.67% NA
Indica II  465 89.20% 3.40% 0.22% 7.10% NA
Indica III  913 89.20% 8.80% 0.00% 2.08% NA
Indica Intermediate  786 89.70% 6.40% 0.00% 3.94% NA
Temperate Japonica  767 1.70% 98.30% 0.00% 0.00% NA
Tropical Japonica  504 4.40% 95.60% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.10% 0.00% 0.83% NA
VI/Aromatic  96 6.20% 40.60% 2.08% 51.04% NA
Intermediate  90 46.70% 40.00% 0.00% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0207897910 A -> G LOC_Os02g14380.1 upstream_gene_variant ; 1451.0bp to feature; MODIFIER silent_mutation Average:23.812; most accessible tissue: Zhenshan97 flag leaf, score: 49.845 N N N N
vg0207897910 A -> G LOC_Os02g14390.1 upstream_gene_variant ; 2551.0bp to feature; MODIFIER silent_mutation Average:23.812; most accessible tissue: Zhenshan97 flag leaf, score: 49.845 N N N N
vg0207897910 A -> G LOC_Os02g14370-LOC_Os02g14380 intergenic_region ; MODIFIER silent_mutation Average:23.812; most accessible tissue: Zhenshan97 flag leaf, score: 49.845 N N N N
vg0207897910 A -> DEL N N silent_mutation Average:23.812; most accessible tissue: Zhenshan97 flag leaf, score: 49.845 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0207897910 NA 1.04E-09 mr1905 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207897910 NA 4.23E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207897910 NA 1.50E-09 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207897910 NA 4.23E-15 mr1324_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207897910 NA 5.72E-14 mr1325_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207897910 NA 6.14E-15 mr1326_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207897910 NA 4.27E-14 mr1333_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207897910 NA 1.59E-09 mr1338_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207897910 NA 6.61E-10 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207897910 NA 8.37E-08 mr1527_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207897910 NA 2.34E-06 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251