Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0207897910:

Variant ID: vg0207897910 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 7897910
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCACCCAGATCAAGACCAGTCCTATAAATCTCAAATAATAACAAGAAACAACCAAATGCTGGAAAAAATGGAAAAATATTTGACCCATAAATCTGAAACA[A/G]
TGCTGGCCCAGTTTTAGAGGGCTATCGGTATTTCCAATACAAAGTCCAGCTATGTTGGCTTTACAGGGAACAAGTCCGAACGTAAATTATGCAGTTAACC

Reverse complement sequence

GGTTAACTGCATAATTTACGTTCGGACTTGTTCCCTGTAAAGCCAACATAGCTGGACTTTGTATTGGAAATACCGATAGCCCTCTAAAACTGGGCCAGCA[T/C]
TGTTTCAGATTTATGGGTCAAATATTTTTCCATTTTTTCCAGCATTTGGTTGTTTCTTGTTATTATTTGAGATTTATAGGACTGGTCTTGATCTGGGTGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.00%	36.00%	0.08%	7.93%	NA
All Indica	2759	91.30%	5.50%	0.04%	3.15%	NA
All Japonica	1512	2.60%	97.20%	0.00%	0.13%	NA
Aus	269	14.10%	1.90%	0.37%	83.64%	NA
Indica I	595	98.30%	1.00%	0.00%	0.67%	NA
Indica II	465	89.20%	3.40%	0.22%	7.10%	NA
Indica III	913	89.20%	8.80%	0.00%	2.08%	NA
Indica Intermediate	786	89.70%	6.40%	0.00%	3.94%	NA
Temperate Japonica	767	1.70%	98.30%	0.00%	0.00%	NA
Tropical Japonica	504	4.40%	95.60%	0.00%	0.00%	NA
Japonica Intermediate	241	2.10%	97.10%	0.00%	0.83%	NA
VI/Aromatic	96	6.20%	40.60%	2.08%	51.04%	NA
Intermediate	90	46.70%	40.00%	0.00%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0207897910	A -> G	LOC_Os02g14380.1	upstream_gene_variant ; 1451.0bp to feature; MODIFIER	silent_mutation	Average:23.812; most accessible tissue: Zhenshan97 flag leaf, score: 49.845	N	N	N	N
vg0207897910	A -> G	LOC_Os02g14390.1	upstream_gene_variant ; 2551.0bp to feature; MODIFIER	silent_mutation	Average:23.812; most accessible tissue: Zhenshan97 flag leaf, score: 49.845	N	N	N	N
vg0207897910	A -> G	LOC_Os02g14370-LOC_Os02g14380	intergenic_region ; MODIFIER	silent_mutation	Average:23.812; most accessible tissue: Zhenshan97 flag leaf, score: 49.845	N	N	N	N
vg0207897910	A -> DEL	N	N	silent_mutation	Average:23.812; most accessible tissue: Zhenshan97 flag leaf, score: 49.845	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0207897910	NA	1.04E-09	mr1905	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207897910	NA	4.23E-07	mr1915	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207897910	NA	1.50E-09	mr1322_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207897910	NA	4.23E-15	mr1324_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207897910	NA	5.72E-14	mr1325_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207897910	NA	6.14E-15	mr1326_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207897910	NA	4.27E-14	mr1333_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207897910	NA	1.59E-09	mr1338_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207897910	NA	6.61E-10	mr1379_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207897910	NA	8.37E-08	mr1527_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207897910	NA	2.34E-06	mr1559_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251