| Variant ID: vg0207897910 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 7897910 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TCACCCAGATCAAGACCAGTCCTATAAATCTCAAATAATAACAAGAAACAACCAAATGCTGGAAAAAATGGAAAAATATTTGACCCATAAATCTGAAACA[A/G]
TGCTGGCCCAGTTTTAGAGGGCTATCGGTATTTCCAATACAAAGTCCAGCTATGTTGGCTTTACAGGGAACAAGTCCGAACGTAAATTATGCAGTTAACC
GGTTAACTGCATAATTTACGTTCGGACTTGTTCCCTGTAAAGCCAACATAGCTGGACTTTGTATTGGAAATACCGATAGCCCTCTAAAACTGGGCCAGCA[T/C]
TGTTTCAGATTTATGGGTCAAATATTTTTCCATTTTTTCCAGCATTTGGTTGTTTCTTGTTATTATTTGAGATTTATAGGACTGGTCTTGATCTGGGTGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.00% | 36.00% | 0.08% | 7.93% | NA |
| All Indica | 2759 | 91.30% | 5.50% | 0.04% | 3.15% | NA |
| All Japonica | 1512 | 2.60% | 97.20% | 0.00% | 0.13% | NA |
| Aus | 269 | 14.10% | 1.90% | 0.37% | 83.64% | NA |
| Indica I | 595 | 98.30% | 1.00% | 0.00% | 0.67% | NA |
| Indica II | 465 | 89.20% | 3.40% | 0.22% | 7.10% | NA |
| Indica III | 913 | 89.20% | 8.80% | 0.00% | 2.08% | NA |
| Indica Intermediate | 786 | 89.70% | 6.40% | 0.00% | 3.94% | NA |
| Temperate Japonica | 767 | 1.70% | 98.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 4.40% | 95.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.10% | 97.10% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 6.20% | 40.60% | 2.08% | 51.04% | NA |
| Intermediate | 90 | 46.70% | 40.00% | 0.00% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0207897910 | A -> G | LOC_Os02g14380.1 | upstream_gene_variant ; 1451.0bp to feature; MODIFIER | silent_mutation | Average:23.812; most accessible tissue: Zhenshan97 flag leaf, score: 49.845 | N | N | N | N |
| vg0207897910 | A -> G | LOC_Os02g14390.1 | upstream_gene_variant ; 2551.0bp to feature; MODIFIER | silent_mutation | Average:23.812; most accessible tissue: Zhenshan97 flag leaf, score: 49.845 | N | N | N | N |
| vg0207897910 | A -> G | LOC_Os02g14370-LOC_Os02g14380 | intergenic_region ; MODIFIER | silent_mutation | Average:23.812; most accessible tissue: Zhenshan97 flag leaf, score: 49.845 | N | N | N | N |
| vg0207897910 | A -> DEL | N | N | silent_mutation | Average:23.812; most accessible tissue: Zhenshan97 flag leaf, score: 49.845 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0207897910 | NA | 1.04E-09 | mr1905 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207897910 | NA | 4.23E-07 | mr1915 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207897910 | NA | 1.50E-09 | mr1322_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207897910 | NA | 4.23E-15 | mr1324_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207897910 | NA | 5.72E-14 | mr1325_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207897910 | NA | 6.14E-15 | mr1326_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207897910 | NA | 4.27E-14 | mr1333_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207897910 | NA | 1.59E-09 | mr1338_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207897910 | NA | 6.61E-10 | mr1379_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207897910 | NA | 8.37E-08 | mr1527_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207897910 | NA | 2.34E-06 | mr1559_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |