\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0207854825:

Variant ID: vg0207854825 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 7854825
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAACTCCAGATATTCAGGAAGTTTAGAGGAAGAATGCCAACCGCTATTTCTCTCGAGAGCATCCTTTACTCATTTTTTCAGTTAACTCATTATTGCTCC[A/G]
TTAGAAGCAAAGAGTGTTGCCACCTTCATTTCAAAATCCCACACATTTCAAAGTCCTACACAATAATAACAAGTTTAATACCAAGACATAGTTATAGATT

Reverse complement sequence

AATCTATAACTATGTCTTGGTATTAAACTTGTTATTATTGTGTAGGACTTTGAAATGTGTGGGATTTTGAAATGAAGGTGGCAACACTCTTTGCTTCTAA[T/C]
GGAGCAATAATGAGTTAACTGAAAAAATGAGTAAAGGATGCTCTCGAGAGAAATAGCGGTTGGCATTCTTCCTCTAAACTTCCTGAATATCTGGAGTTTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.10% 2.50% 1.38% 0.00% NA
All Indica  2759 93.40% 4.20% 2.32% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 83.50% 10.30% 6.22% 0.00% NA
Indica II  465 98.30% 0.00% 1.72% 0.00% NA
Indica III  913 98.10% 1.60% 0.22% 0.00% NA
Indica Intermediate  786 92.60% 5.20% 2.16% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 0.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0207854825 A -> G LOC_Os02g14290.1 upstream_gene_variant ; 2648.0bp to feature; MODIFIER silent_mutation Average:29.937; most accessible tissue: Callus, score: 52.734 N N N N
vg0207854825 A -> G LOC_Os02g14310.1 upstream_gene_variant ; 2291.0bp to feature; MODIFIER silent_mutation Average:29.937; most accessible tissue: Callus, score: 52.734 N N N N
vg0207854825 A -> G LOC_Os02g14320.1 upstream_gene_variant ; 3127.0bp to feature; MODIFIER silent_mutation Average:29.937; most accessible tissue: Callus, score: 52.734 N N N N
vg0207854825 A -> G LOC_Os02g14290.2 upstream_gene_variant ; 2648.0bp to feature; MODIFIER silent_mutation Average:29.937; most accessible tissue: Callus, score: 52.734 N N N N
vg0207854825 A -> G LOC_Os02g14300.1 downstream_gene_variant ; 403.0bp to feature; MODIFIER silent_mutation Average:29.937; most accessible tissue: Callus, score: 52.734 N N N N
vg0207854825 A -> G LOC_Os02g14300-LOC_Os02g14310 intergenic_region ; MODIFIER silent_mutation Average:29.937; most accessible tissue: Callus, score: 52.734 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0207854825 NA 3.53E-06 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207854825 NA 3.56E-06 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207854825 NA 4.94E-06 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207854825 9.31E-07 9.31E-07 mr1153_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207854825 NA 6.90E-06 mr1169_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207854825 2.50E-06 NA mr1170_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207854825 NA 2.88E-06 mr1201_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207854825 1.53E-06 2.97E-06 mr1240_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207854825 NA 1.49E-06 mr1260_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207854825 4.68E-06 4.68E-06 mr1303_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207854825 1.05E-07 1.05E-07 mr1344_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207854825 1.69E-06 3.88E-07 mr1351_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207854825 3.68E-06 3.68E-06 mr1353_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207854825 1.18E-06 1.18E-06 mr1357_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207854825 NA 3.37E-07 mr1376_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207854825 9.44E-06 4.71E-07 mr1381_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207854825 NA 1.53E-06 mr1396_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207854825 NA 1.97E-07 mr1431_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207854825 NA 7.69E-06 mr1432_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207854825 1.85E-07 1.85E-07 mr1464_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207854825 NA 5.57E-06 mr1469_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207854825 NA 6.41E-06 mr1505_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207854825 1.38E-07 1.38E-07 mr1512_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207854825 2.57E-06 2.57E-06 mr1569_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207854825 NA 1.99E-07 mr1617_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207854825 8.53E-06 NA mr1637_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207854825 7.18E-06 7.18E-06 mr1640_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207854825 NA 5.40E-06 mr1661_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207854825 1.07E-06 6.13E-10 mr1696_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207854825 NA 1.97E-06 mr1767_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207854825 1.96E-06 1.96E-06 mr1885_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207854825 4.47E-06 1.08E-07 mr1909_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207854825 NA 7.16E-06 mr1980_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251