Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0207688311:

Variant ID: vg0207688311 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 7688311
Reference Allele: A	Alternative Allele: T
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGATCATCACAACCAGCTCCACTTTCTTTCCACTGGGACTGAAAACGTTTGGTTGGGTCTGCCCTGAGACTAAAAAAAAAAACTCTATAATGTTTTTTTT[A/T]
AAAAAAGCCTTGAAATTTAGCTGTGGGCTTAACAGGAAAATTTGGCTAGTTATCTTTCATCAATTACCATCACCTACTAGCTGAATAATTAGGAGTATTT

Reverse complement sequence

AAATACTCCTAATTATTCAGCTAGTAGGTGATGGTAATTGATGAAAGATAACTAGCCAAATTTTCCTGTTAAGCCCACAGCTAAATTTCAAGGCTTTTTT[T/A]
AAAAAAAACATTATAGAGTTTTTTTTTTTAGTCTCAGGGCAGACCCAACCAAACGTTTTCAGTCCCAGTGGAAAGAAAGTGGAGCTGGTTGTGATGATCA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.70%	24.30%	1.06%	8.95%	NA
All Indica	2759	92.80%	0.50%	0.87%	5.80%	NA
All Japonica	1512	28.50%	71.20%	0.00%	0.33%	NA
Aus	269	14.90%	5.20%	6.69%	73.23%	NA
Indica I	595	99.70%	0.00%	0.17%	0.17%	NA
Indica II	465	97.00%	0.90%	0.43%	1.72%	NA
Indica III	913	87.10%	0.30%	1.53%	11.06%	NA
Indica Intermediate	786	91.90%	0.90%	0.89%	6.36%	NA
Temperate Japonica	767	9.10%	90.90%	0.00%	0.00%	NA
Tropical Japonica	504	42.70%	57.30%	0.00%	0.00%	NA
Japonica Intermediate	241	60.60%	37.30%	0.00%	2.07%	NA
VI/Aromatic	96	16.70%	24.00%	6.25%	53.12%	NA
Intermediate	90	63.30%	23.30%	2.22%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0207688311	A -> T	LOC_Os02g14080.1	upstream_gene_variant ; 1199.0bp to feature; MODIFIER	silent_mutation	Average:58.29; most accessible tissue: Minghui63 root, score: 78.091	N	N	N	N
vg0207688311	A -> T	LOC_Os02g14090.1	upstream_gene_variant ; 1931.0bp to feature; MODIFIER	silent_mutation	Average:58.29; most accessible tissue: Minghui63 root, score: 78.091	N	N	N	N
vg0207688311	A -> T	LOC_Os02g14059.1	downstream_gene_variant ; 805.0bp to feature; MODIFIER	silent_mutation	Average:58.29; most accessible tissue: Minghui63 root, score: 78.091	N	N	N	N
vg0207688311	A -> T	LOC_Os02g14059.2	downstream_gene_variant ; 805.0bp to feature; MODIFIER	silent_mutation	Average:58.29; most accessible tissue: Minghui63 root, score: 78.091	N	N	N	N
vg0207688311	A -> T	LOC_Os02g14059-LOC_Os02g14080	intergenic_region ; MODIFIER	silent_mutation	Average:58.29; most accessible tissue: Minghui63 root, score: 78.091	N	N	N	N
vg0207688311	A -> DEL	N	N	silent_mutation	Average:58.29; most accessible tissue: Minghui63 root, score: 78.091	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0207688311	NA	3.04E-26	mr1024	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311	NA	4.27E-10	mr1198	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311	NA	1.10E-13	mr1218	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311	NA	1.15E-26	mr1223	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311	NA	9.63E-16	mr1228	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311	NA	3.30E-06	mr1231	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311	NA	1.06E-16	mr1323	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311	NA	1.66E-12	mr1326	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311	NA	1.00E-37	mr1350	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311	NA	6.78E-17	mr1361	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311	3.35E-07	3.95E-17	mr1557	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311	NA	3.97E-39	mr1601	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311	NA	2.46E-30	mr1638	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311	NA	6.96E-13	mr1641	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311	NA	9.26E-07	mr1646	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311	NA	2.89E-06	mr1653	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311	NA	3.75E-06	mr1881	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311	1.94E-07	3.22E-06	mr1884	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311	4.89E-06	5.97E-07	mr1884	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311	NA	1.39E-34	mr1944	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311	NA	8.47E-14	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311	NA	9.18E-73	mr1087_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311	NA	7.43E-52	mr1089_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311	NA	2.27E-50	mr1093_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311	NA	1.85E-52	mr1136_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311	NA	1.77E-17	mr1199_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311	NA	1.10E-54	mr1235_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311	NA	2.47E-60	mr1241_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311	NA	1.76E-43	mr1243_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311	NA	6.79E-75	mr1246_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311	NA	4.65E-40	mr1251_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311	NA	3.45E-20	mr1255_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311	NA	5.56E-35	mr1257_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311	NA	4.72E-24	mr1350_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311	NA	6.00E-09	mr1379_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311	NA	3.91E-53	mr1404_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311	NA	4.07E-40	mr1435_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311	NA	1.07E-33	mr1448_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311	NA	1.16E-06	mr1559_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311	NA	3.83E-62	mr1599_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311	NA	6.88E-47	mr1620_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311	NA	8.18E-08	mr1700_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311	NA	9.19E-07	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311	NA	2.30E-39	mr1862_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251