\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0207688311:

Variant ID: vg0207688311 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 7688311
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGATCATCACAACCAGCTCCACTTTCTTTCCACTGGGACTGAAAACGTTTGGTTGGGTCTGCCCTGAGACTAAAAAAAAAAACTCTATAATGTTTTTTTT[A/T]
AAAAAAGCCTTGAAATTTAGCTGTGGGCTTAACAGGAAAATTTGGCTAGTTATCTTTCATCAATTACCATCACCTACTAGCTGAATAATTAGGAGTATTT

Reverse complement sequence

AAATACTCCTAATTATTCAGCTAGTAGGTGATGGTAATTGATGAAAGATAACTAGCCAAATTTTCCTGTTAAGCCCACAGCTAAATTTCAAGGCTTTTTT[T/A]
AAAAAAAACATTATAGAGTTTTTTTTTTTAGTCTCAGGGCAGACCCAACCAAACGTTTTCAGTCCCAGTGGAAAGAAAGTGGAGCTGGTTGTGATGATCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.70% 24.30% 1.06% 8.95% NA
All Indica  2759 92.80% 0.50% 0.87% 5.80% NA
All Japonica  1512 28.50% 71.20% 0.00% 0.33% NA
Aus  269 14.90% 5.20% 6.69% 73.23% NA
Indica I  595 99.70% 0.00% 0.17% 0.17% NA
Indica II  465 97.00% 0.90% 0.43% 1.72% NA
Indica III  913 87.10% 0.30% 1.53% 11.06% NA
Indica Intermediate  786 91.90% 0.90% 0.89% 6.36% NA
Temperate Japonica  767 9.10% 90.90% 0.00% 0.00% NA
Tropical Japonica  504 42.70% 57.30% 0.00% 0.00% NA
Japonica Intermediate  241 60.60% 37.30% 0.00% 2.07% NA
VI/Aromatic  96 16.70% 24.00% 6.25% 53.12% NA
Intermediate  90 63.30% 23.30% 2.22% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0207688311 A -> T LOC_Os02g14080.1 upstream_gene_variant ; 1199.0bp to feature; MODIFIER silent_mutation Average:58.29; most accessible tissue: Minghui63 root, score: 78.091 N N N N
vg0207688311 A -> T LOC_Os02g14090.1 upstream_gene_variant ; 1931.0bp to feature; MODIFIER silent_mutation Average:58.29; most accessible tissue: Minghui63 root, score: 78.091 N N N N
vg0207688311 A -> T LOC_Os02g14059.1 downstream_gene_variant ; 805.0bp to feature; MODIFIER silent_mutation Average:58.29; most accessible tissue: Minghui63 root, score: 78.091 N N N N
vg0207688311 A -> T LOC_Os02g14059.2 downstream_gene_variant ; 805.0bp to feature; MODIFIER silent_mutation Average:58.29; most accessible tissue: Minghui63 root, score: 78.091 N N N N
vg0207688311 A -> T LOC_Os02g14059-LOC_Os02g14080 intergenic_region ; MODIFIER silent_mutation Average:58.29; most accessible tissue: Minghui63 root, score: 78.091 N N N N
vg0207688311 A -> DEL N N silent_mutation Average:58.29; most accessible tissue: Minghui63 root, score: 78.091 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0207688311 NA 3.04E-26 mr1024 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311 NA 4.27E-10 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311 NA 1.10E-13 mr1218 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311 NA 1.15E-26 mr1223 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311 NA 9.63E-16 mr1228 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311 NA 3.30E-06 mr1231 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311 NA 1.06E-16 mr1323 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311 NA 1.66E-12 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311 NA 1.00E-37 mr1350 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311 NA 6.78E-17 mr1361 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311 3.35E-07 3.95E-17 mr1557 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311 NA 3.97E-39 mr1601 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311 NA 2.46E-30 mr1638 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311 NA 6.96E-13 mr1641 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311 NA 9.26E-07 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311 NA 2.89E-06 mr1653 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311 NA 3.75E-06 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311 1.94E-07 3.22E-06 mr1884 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311 4.89E-06 5.97E-07 mr1884 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311 NA 1.39E-34 mr1944 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311 NA 8.47E-14 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311 NA 9.18E-73 mr1087_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311 NA 7.43E-52 mr1089_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311 NA 2.27E-50 mr1093_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311 NA 1.85E-52 mr1136_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311 NA 1.77E-17 mr1199_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311 NA 1.10E-54 mr1235_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311 NA 2.47E-60 mr1241_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311 NA 1.76E-43 mr1243_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311 NA 6.79E-75 mr1246_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311 NA 4.65E-40 mr1251_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311 NA 3.45E-20 mr1255_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311 NA 5.56E-35 mr1257_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311 NA 4.72E-24 mr1350_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311 NA 6.00E-09 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311 NA 3.91E-53 mr1404_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311 NA 4.07E-40 mr1435_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311 NA 1.07E-33 mr1448_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311 NA 1.16E-06 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311 NA 3.83E-62 mr1599_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311 NA 6.88E-47 mr1620_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311 NA 8.18E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311 NA 9.19E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207688311 NA 2.30E-39 mr1862_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251