Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0207676313:

Variant ID: vg0207676313 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 7676313
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTAAATTTTATAAAACTACAGTACTTTGATCGAAGTATTATAAAAGTACAGATTTAAGGCGTCGTATTATAAAACTACATATTTAACACAAAATTTATCA[C/T]
AAAACTATAGATTTAATACTAGAGTATCACAAAACTACATATTTTACAGCTTAAATTCCTACCACTACTGCTATGTTAGAGTGATAAATGTGTAGTTTTG

Reverse complement sequence

CAAAACTACACATTTATCACTCTAACATAGCAGTAGTGGTAGGAATTTAAGCTGTAAAATATGTAGTTTTGTGATACTCTAGTATTAAATCTATAGTTTT[G/A]
TGATAAATTTTGTGTTAAATATGTAGTTTTATAATACGACGCCTTAAATCTGTACTTTTATAATACTTCGATCAAAGTACTGTAGTTTTATAAAATTTAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.10%	12.70%	0.30%	0.00%	NA
All Indica	2759	90.10%	9.80%	0.14%	0.00%	NA
All Japonica	1512	79.20%	20.10%	0.66%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	99.00%	1.00%	0.00%	0.00%	NA
Indica II	465	96.60%	3.20%	0.22%	0.00%	NA
Indica III	913	80.80%	19.10%	0.11%	0.00%	NA
Indica Intermediate	786	90.20%	9.50%	0.25%	0.00%	NA
Temperate Japonica	767	94.10%	4.70%	1.17%	0.00%	NA
Tropical Japonica	504	62.70%	37.30%	0.00%	0.00%	NA
Japonica Intermediate	241	66.40%	33.20%	0.41%	0.00%	NA
VI/Aromatic	96	84.40%	15.60%	0.00%	0.00%	NA
Intermediate	90	91.10%	8.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0207676313	C -> T	LOC_Os02g14040.1	upstream_gene_variant ; 3549.0bp to feature; MODIFIER	silent_mutation	Average:41.509; most accessible tissue: Callus, score: 61.536	N	N	N	N
vg0207676313	C -> T	LOC_Os02g14059.1	upstream_gene_variant ; 498.0bp to feature; MODIFIER	silent_mutation	Average:41.509; most accessible tissue: Callus, score: 61.536	N	N	N	N
vg0207676313	C -> T	LOC_Os02g14059.2	upstream_gene_variant ; 498.0bp to feature; MODIFIER	silent_mutation	Average:41.509; most accessible tissue: Callus, score: 61.536	N	N	N	N
vg0207676313	C -> T	LOC_Os02g14040-LOC_Os02g14059	intergenic_region ; MODIFIER	silent_mutation	Average:41.509; most accessible tissue: Callus, score: 61.536	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0207676313	9.76E-06	NA	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207676313	9.38E-06	NA	mr1137_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207676313	8.05E-07	8.05E-07	mr1147_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207676313	NA	1.50E-06	mr1149_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207676313	NA	9.79E-06	mr1204_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207676313	6.29E-06	6.29E-06	mr1279_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207676313	5.64E-07	5.64E-07	mr1313_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207676313	NA	2.14E-06	mr1369_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207676313	NA	5.88E-07	mr1441_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207676313	NA	4.46E-07	mr1453_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207676313	NA	3.48E-06	mr1467_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207676313	NA	5.83E-06	mr1467_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207676313	2.60E-07	2.60E-07	mr1473_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207676313	NA	7.40E-06	mr1556_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207676313	NA	3.10E-06	mr1596_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207676313	NA	4.94E-06	mr1596_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207676313	2.11E-07	2.11E-07	mr1630_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207676313	5.05E-06	5.06E-06	mr1703_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207676313	NA	4.67E-06	mr1764_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207676313	1.32E-06	1.32E-06	mr1777_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207676313	2.40E-06	2.40E-06	mr1777_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207676313	NA	6.90E-07	mr1824_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207676313	6.07E-06	6.07E-06	mr1985_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251