| Variant ID: vg0207577589 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 7577589 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TAAATCAATCATAGAAACCCAGATAATTTAGTATTGCTTACTTTGCTTACAATCTGGTTAAAATACCTTATACTTAGATTGGGAGAGTAAGTAAGATTTG[G/A]
TTGATTTCCGGGTGGCTAGTACTGTCTCGATCGATATAAGTTTTACCAGGTACTTATGTCGAACGAACGGGTACGACCGCAGTTTCTAGAATAGGGACAT
ATGTCCCTATTCTAGAAACTGCGGTCGTACCCGTTCGTTCGACATAAGTACCTGGTAAAACTTATATCGATCGAGACAGTACTAGCCACCCGGAAATCAA[C/T]
CAAATCTTACTTACTCTCCCAATCTAAGTATAAGGTATTTTAACCAGATTGTAAGCAAAGTAAGCAATACTAAATTATCTGGGTTTCTATGATTGATTTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.00% | 7.90% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 97.50% | 2.40% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 16.00% | 83.60% | 0.37% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.40% | 3.40% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 37.50% | 62.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0207577589 | G -> A | LOC_Os02g13920.1 | upstream_gene_variant ; 427.0bp to feature; MODIFIER | silent_mutation | Average:20.224; most accessible tissue: Zhenshan97 root, score: 30.989 | N | N | N | N |
| vg0207577589 | G -> A | LOC_Os02g13930.1 | downstream_gene_variant ; 4656.0bp to feature; MODIFIER | silent_mutation | Average:20.224; most accessible tissue: Zhenshan97 root, score: 30.989 | N | N | N | N |
| vg0207577589 | G -> A | LOC_Os02g13910-LOC_Os02g13920 | intergenic_region ; MODIFIER | silent_mutation | Average:20.224; most accessible tissue: Zhenshan97 root, score: 30.989 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0207577589 | NA | 5.65E-06 | mr1029 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207577589 | NA | 3.72E-12 | mr1570 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207577589 | NA | 2.07E-09 | mr1585 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207577589 | NA | 3.94E-08 | mr1803 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207577589 | 2.89E-06 | NA | mr1981 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207577589 | NA | 5.01E-10 | mr1166_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207577589 | NA | 1.43E-06 | mr1344_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207577589 | NA | 4.04E-08 | mr1585_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207577589 | NA | 5.62E-12 | mr1803_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |