Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0207577589:

Variant ID: vg0207577589 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 7577589
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAAATCAATCATAGAAACCCAGATAATTTAGTATTGCTTACTTTGCTTACAATCTGGTTAAAATACCTTATACTTAGATTGGGAGAGTAAGTAAGATTTG[G/A]
TTGATTTCCGGGTGGCTAGTACTGTCTCGATCGATATAAGTTTTACCAGGTACTTATGTCGAACGAACGGGTACGACCGCAGTTTCTAGAATAGGGACAT

Reverse complement sequence

ATGTCCCTATTCTAGAAACTGCGGTCGTACCCGTTCGTTCGACATAAGTACCTGGTAAAACTTATATCGATCGAGACAGTACTAGCCACCCGGAAATCAA[C/T]
CAAATCTTACTTACTCTCCCAATCTAAGTATAAGGTATTTTAACCAGATTGTAAGCAAAGTAAGCAATACTAAATTATCTGGGTTTCTATGATTGATTTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.00%	7.90%	0.04%	0.00%	NA
All Indica	2759	97.50%	2.40%	0.04%	0.00%	NA
All Japonica	1512	99.50%	0.50%	0.00%	0.00%	NA
Aus	269	16.00%	83.60%	0.37%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	98.90%	1.10%	0.00%	0.00%	NA
Indica III	913	96.30%	3.70%	0.00%	0.00%	NA
Indica Intermediate	786	96.40%	3.40%	0.13%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.20%	0.80%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	1.70%	0.00%	0.00%	NA
VI/Aromatic	96	37.50%	62.50%	0.00%	0.00%	NA
Intermediate	90	83.30%	16.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0207577589	G -> A	LOC_Os02g13920.1	upstream_gene_variant ; 427.0bp to feature; MODIFIER	silent_mutation	Average:20.224; most accessible tissue: Zhenshan97 root, score: 30.989	N	N	N	N
vg0207577589	G -> A	LOC_Os02g13930.1	downstream_gene_variant ; 4656.0bp to feature; MODIFIER	silent_mutation	Average:20.224; most accessible tissue: Zhenshan97 root, score: 30.989	N	N	N	N
vg0207577589	G -> A	LOC_Os02g13910-LOC_Os02g13920	intergenic_region ; MODIFIER	silent_mutation	Average:20.224; most accessible tissue: Zhenshan97 root, score: 30.989	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0207577589	NA	5.65E-06	mr1029	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207577589	NA	3.72E-12	mr1570	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207577589	NA	2.07E-09	mr1585	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207577589	NA	3.94E-08	mr1803	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207577589	2.89E-06	NA	mr1981	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207577589	NA	5.01E-10	mr1166_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207577589	NA	1.43E-06	mr1344_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207577589	NA	4.04E-08	mr1585_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207577589	NA	5.62E-12	mr1803_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251