\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0207577589:

Variant ID: vg0207577589 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 7577589
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAAATCAATCATAGAAACCCAGATAATTTAGTATTGCTTACTTTGCTTACAATCTGGTTAAAATACCTTATACTTAGATTGGGAGAGTAAGTAAGATTTG[G/A]
TTGATTTCCGGGTGGCTAGTACTGTCTCGATCGATATAAGTTTTACCAGGTACTTATGTCGAACGAACGGGTACGACCGCAGTTTCTAGAATAGGGACAT

Reverse complement sequence

ATGTCCCTATTCTAGAAACTGCGGTCGTACCCGTTCGTTCGACATAAGTACCTGGTAAAACTTATATCGATCGAGACAGTACTAGCCACCCGGAAATCAA[C/T]
CAAATCTTACTTACTCTCCCAATCTAAGTATAAGGTATTTTAACCAGATTGTAAGCAAAGTAAGCAATACTAAATTATCTGGGTTTCTATGATTGATTTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.00% 7.90% 0.04% 0.00% NA
All Indica  2759 97.50% 2.40% 0.04% 0.00% NA
All Japonica  1512 99.50% 0.50% 0.00% 0.00% NA
Aus  269 16.00% 83.60% 0.37% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 96.30% 3.70% 0.00% 0.00% NA
Indica Intermediate  786 96.40% 3.40% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.80% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 37.50% 62.50% 0.00% 0.00% NA
Intermediate  90 83.30% 16.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0207577589 G -> A LOC_Os02g13920.1 upstream_gene_variant ; 427.0bp to feature; MODIFIER silent_mutation Average:20.224; most accessible tissue: Zhenshan97 root, score: 30.989 N N N N
vg0207577589 G -> A LOC_Os02g13930.1 downstream_gene_variant ; 4656.0bp to feature; MODIFIER silent_mutation Average:20.224; most accessible tissue: Zhenshan97 root, score: 30.989 N N N N
vg0207577589 G -> A LOC_Os02g13910-LOC_Os02g13920 intergenic_region ; MODIFIER silent_mutation Average:20.224; most accessible tissue: Zhenshan97 root, score: 30.989 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0207577589 NA 5.65E-06 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207577589 NA 3.72E-12 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207577589 NA 2.07E-09 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207577589 NA 3.94E-08 mr1803 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207577589 2.89E-06 NA mr1981 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207577589 NA 5.01E-10 mr1166_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207577589 NA 1.43E-06 mr1344_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207577589 NA 4.04E-08 mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207577589 NA 5.62E-12 mr1803_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251