\
| Variant ID: vg0207379019 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 7379019 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTGTGATGTATTTGAGTAATTTCTTAGGATATTGTGATGTATTTGATTTGTGTGTATAAGTAACTTTATGATTTGTGATGTGGATTTGGTGATGTGAATT[T/A]
GGGATGTTAGTTAGATTTGGGGATTTGCCTACTTGATTCGGGAGAAAATAAAAAGGAAAAAAGAAAAAGAAAAAGGGACCATCTGCACTGCCGCTATTTT
AAAATAGCGGCAGTGCAGATGGTCCCTTTTTCTTTTTCTTTTTTCCTTTTTATTTTCTCCCGAATCAAGTAGGCAAATCCCCAAATCTAACTAACATCCC[A/T]
AATTCACATCACCAAATCCACATCACAAATCATAAAGTTACTTATACACACAAATCAAATACATCACAATATCCTAAGAAATTACTCAAATACATCACAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.80% | 7.20% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 77.90% | 22.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 73.30% | 26.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 84.30% | 15.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 79.30% | 20.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0207379019 | T -> A | LOC_Os02g13720.1 | upstream_gene_variant ; 2931.0bp to feature; MODIFIER | silent_mutation | Average:35.871; most accessible tissue: Minghui63 young leaf, score: 49.581 | N | N | N | N |
| vg0207379019 | T -> A | LOC_Os02g13710-LOC_Os02g13720 | intergenic_region ; MODIFIER | silent_mutation | Average:35.871; most accessible tissue: Minghui63 young leaf, score: 49.581 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0207379019 | 6.68E-09 | 2.86E-10 | mr1057 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207379019 | NA | 1.05E-08 | mr1057 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207379019 | NA | 7.48E-06 | mr1201 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207379019 | NA | 2.36E-06 | mr1274 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207379019 | NA | 6.10E-08 | mr1514 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207379019 | 7.84E-13 | 3.89E-15 | mr1057_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207379019 | 1.77E-06 | 2.68E-11 | mr1057_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207379019 | 7.03E-06 | NA | mr1758_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207379019 | NA | 7.84E-06 | mr1887_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207379019 | NA | 7.08E-07 | mr1982_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |