\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0207379019:

Variant ID: vg0207379019 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 7379019
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGTGATGTATTTGAGTAATTTCTTAGGATATTGTGATGTATTTGATTTGTGTGTATAAGTAACTTTATGATTTGTGATGTGGATTTGGTGATGTGAATT[T/A]
GGGATGTTAGTTAGATTTGGGGATTTGCCTACTTGATTCGGGAGAAAATAAAAAGGAAAAAAGAAAAAGAAAAAGGGACCATCTGCACTGCCGCTATTTT

Reverse complement sequence

AAAATAGCGGCAGTGCAGATGGTCCCTTTTTCTTTTTCTTTTTTCCTTTTTATTTTCTCCCGAATCAAGTAGGCAAATCCCCAAATCTAACTAACATCCC[A/T]
AATTCACATCACCAAATCCACATCACAAATCATAAAGTTACTTATACACACAAATCAAATACATCACAATATCCTAAGAAATTACTCAAATACATCACAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.80% 7.20% 0.00% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 77.90% 22.10% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 73.30% 26.70% 0.00% 0.00% NA
Tropical Japonica  504 84.30% 15.70% 0.00% 0.00% NA
Japonica Intermediate  241 79.30% 20.70% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0207379019 T -> A LOC_Os02g13720.1 upstream_gene_variant ; 2931.0bp to feature; MODIFIER silent_mutation Average:35.871; most accessible tissue: Minghui63 young leaf, score: 49.581 N N N N
vg0207379019 T -> A LOC_Os02g13710-LOC_Os02g13720 intergenic_region ; MODIFIER silent_mutation Average:35.871; most accessible tissue: Minghui63 young leaf, score: 49.581 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0207379019 6.68E-09 2.86E-10 mr1057 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207379019 NA 1.05E-08 mr1057 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207379019 NA 7.48E-06 mr1201 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207379019 NA 2.36E-06 mr1274 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207379019 NA 6.10E-08 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207379019 7.84E-13 3.89E-15 mr1057_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207379019 1.77E-06 2.68E-11 mr1057_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207379019 7.03E-06 NA mr1758_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207379019 NA 7.84E-06 mr1887_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207379019 NA 7.08E-07 mr1982_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251