\
| Variant ID: vg0207179503 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 7179503 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 272. )
CGGTGGCGATGGTAATGGGCAGTTGACCTGGCAGGCCTCGAGACTCTGGTAGCATTGCCCGTCGCTGACCTCACAACACCAGCAGTTCTTGCAGAGGTCT[G/T]
GTCGCTTTGCACATAGCGGCCCAGGTGGTATGTTGATCTTCTCTCCCAACATGTCACCATTGCTCCGGCCTATTAAATATTAATTAATTAATTACAACGT
ACGTTGTAATTAATTAATTAATATTTAATAGGCCGGAGCAATGGTGACATGTTGGGAGAGAAGATCAACATACCACCTGGGCCGCTATGTGCAAAGCGAC[C/A]
AGACCTCTGCAAGAACTGCTGGTGTTGTGAGGTCAGCGACGGGCAATGCTACCAGAGTCTCGAGGCCTGCCAGGTCAACTGCCCATTACCATCGCCACCG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.50% | 5.80% | 1.69% | 0.00% | NA |
| All Indica | 2759 | 88.20% | 9.10% | 2.72% | 0.00% | NA |
| All Japonica | 1512 | 99.30% | 0.70% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.30% | 0.30% | 4.37% | 0.00% | NA |
| Indica II | 465 | 62.20% | 32.90% | 4.95% | 0.00% | NA |
| Indica III | 913 | 98.10% | 1.80% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 86.60% | 10.20% | 3.18% | 0.00% | NA |
| Temperate Japonica | 767 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.90% | 1.70% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 14.40% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0207179503 | G -> T | LOC_Os02g13450.1 | missense_variant ; p.Pro51Gln; MODERATE | nonsynonymous_codon ; P51Q | Average:60.321; most accessible tissue: Zhenshan97 young leaf, score: 87.004 | unknown | unknown | DELETERIOUS | 0.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0207179503 | NA | 4.75E-09 | mr1077_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207179503 | NA | 2.56E-07 | mr1149_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207179503 | NA | 4.64E-07 | mr1347_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207179503 | NA | 5.19E-06 | mr1360_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207179503 | NA | 6.89E-06 | mr1360_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207179503 | 1.53E-06 | 4.40E-07 | mr1388_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207179503 | NA | 9.68E-06 | mr1402_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207179503 | NA | 4.18E-06 | mr1550_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207179503 | NA | 3.72E-06 | mr1592_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207179503 | NA | 4.27E-06 | mr1763_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207179503 | NA | 1.37E-07 | mr1828_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207179503 | NA | 1.57E-06 | mr1901_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |