\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0207115454:

Variant ID: vg0207115454 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 7115454
Reference Allele: TAAlternative Allele: AA,TAA,T
Primary Allele: TASecondary Allele: AA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTGGAAGGGTGTTAGGCTCAGTTAGTTTCTTTGAGTTAACAACTCACTCTCTTCATTTTCCATTCTCGTGCTTTTCAAACTACTAAACGTGTGTTTTTTT[TA/AA,TAA,T]
AAAAAATTTATACATGAAAGTTGCTTTTAAAAATCATATTGATTCACTTTCCAAATTTTTTGCTAATACTTAATTAATCACGTGTTAATAGACTACTTCG

Reverse complement sequence

CGAAGTAGTCTATTAACACGTGATTAATTAAGTATTAGCAAAAAATTTGGAAAGTGAATCAATATGATTTTTAAAAGCAACTTTCATGTATAAATTTTTT[TA/TT,TTA,A]
AAAAAAACACACGTTTAGTAGTTTGAAAAGCACGAGAATGGAAAATGAAGAGAGTGAGTTGTTAACTCAAAGAAACTAACTGAGCCTAACACCCTTCCAG

Allele Frequencies:

Populations Population SizeFrequency of TA(primary allele) Frequency of AA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.50% 12.20% 2.24% 0.00% TAA: 8.02%; T: 0.11%
All Indica  2759 80.50% 5.80% 0.14% 0.00% TAA: 13.37%; T: 0.14%
All Japonica  1512 82.30% 10.80% 6.68% 0.00% TAA: 0.20%
Aus  269 32.70% 66.50% 0.00% 0.00% T: 0.37%; TAA: 0.37%
Indica I  595 89.40% 0.30% 0.17% 0.00% TAA: 9.75%; T: 0.34%
Indica II  465 77.00% 13.80% 0.22% 0.00% TAA: 9.03%
Indica III  913 84.60% 3.50% 0.11% 0.00% TAA: 11.61%; T: 0.22%
Indica Intermediate  786 71.10% 8.00% 0.13% 0.00% TAA: 20.74%
Temperate Japonica  767 85.30% 6.90% 7.82% 0.00% NA
Tropical Japonica  504 87.70% 7.70% 4.37% 0.00% TAA: 0.20%
Japonica Intermediate  241 61.80% 29.50% 7.88% 0.00% TAA: 0.83%
VI/Aromatic  96 38.50% 60.40% 0.00% 0.00% TAA: 1.04%
Intermediate  90 77.80% 15.60% 1.11% 0.00% TAA: 5.56%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0207115454 TA -> TAA LOC_Os02g13330.1 upstream_gene_variant ; 3727.0bp to feature; MODIFIER silent_mutation Average:89.95; most accessible tissue: Callus, score: 95.669 N N N N
vg0207115454 TA -> TAA LOC_Os02g13340.1 upstream_gene_variant ; 330.0bp to feature; MODIFIER silent_mutation Average:89.95; most accessible tissue: Callus, score: 95.669 N N N N
vg0207115454 TA -> TAA LOC_Os02g13330-LOC_Os02g13340 intergenic_region ; MODIFIER silent_mutation Average:89.95; most accessible tissue: Callus, score: 95.669 N N N N
vg0207115454 TA -> T LOC_Os02g13330.1 upstream_gene_variant ; 3726.0bp to feature; MODIFIER silent_mutation Average:89.95; most accessible tissue: Callus, score: 95.669 N N N N
vg0207115454 TA -> T LOC_Os02g13340.1 upstream_gene_variant ; 331.0bp to feature; MODIFIER silent_mutation Average:89.95; most accessible tissue: Callus, score: 95.669 N N N N
vg0207115454 TA -> T LOC_Os02g13330-LOC_Os02g13340 intergenic_region ; MODIFIER silent_mutation Average:89.95; most accessible tissue: Callus, score: 95.669 N N N N
vg0207115454 TA -> AA LOC_Os02g13330.1 upstream_gene_variant ; 3725.0bp to feature; MODIFIER silent_mutation Average:89.95; most accessible tissue: Callus, score: 95.669 N N N N
vg0207115454 TA -> AA LOC_Os02g13340.1 upstream_gene_variant ; 332.0bp to feature; MODIFIER silent_mutation Average:89.95; most accessible tissue: Callus, score: 95.669 N N N N
vg0207115454 TA -> AA LOC_Os02g13330-LOC_Os02g13340 intergenic_region ; MODIFIER silent_mutation Average:89.95; most accessible tissue: Callus, score: 95.669 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0207115454 TA AA -0.01 -0.01 -0.01 -0.01 -0.01 -0.01
vg0207115454 TA T -0.06 -0.02 -0.02 -0.03 -0.04 -0.06
vg0207115454 TA TAA 0.02 0.04 -0.03 0.0 -0.03 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0207115454 9.35E-06 NA mr1123 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207115454 NA 2.31E-10 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207115454 NA 2.23E-06 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207115454 3.78E-06 NA mr1113_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207115454 5.02E-08 NA mr1114_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207115454 2.65E-07 NA mr1117_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207115454 1.43E-06 NA mr1119_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207115454 7.27E-08 NA mr1120_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207115454 7.17E-07 NA mr1123_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207115454 1.18E-06 NA mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207115454 1.87E-07 NA mr1247_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207115454 NA 7.36E-08 mr1612_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251