\
| Variant ID: vg0206770457 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 6770457 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TGATTGCATTAAATACTTGACCAAGATTTCTGCCAATGAAGCCACAAGGCATGCATGCAACGCAGCATACAATGTTGTGTTCGTTTGCTTGTGTTGTAAC[A/T]
AATTCCCTTCACACGGAAGAGATACCTATTAGCATATGATTAATTAAGTATTAACTTTAAAAAACTTAAAAATGGATCAATAAAATTTTTAAAATAACTT
AAGTTATTTTAAAAATTTTATTGATCCATTTTTAAGTTTTTTAAAGTTAATACTTAATTAATCATATGCTAATAGGTATCTCTTCCGTGTGAAGGGAATT[T/A]
GTTACAACACAAGCAAACGAACACAACATTGTATGCTGCGTTGCATGCATGCCTTGTGGCTTCATTGGCAGAAATCTTGGTCAAGTATTTAATGCAATCA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.10% | 45.00% | 0.76% | 1.12% | NA |
| All Indica | 2759 | 88.30% | 8.50% | 1.30% | 1.88% | NA |
| All Japonica | 1512 | 1.70% | 98.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 0.70% | 99.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 94.50% | 2.00% | 1.68% | 1.85% | NA |
| Indica II | 465 | 81.50% | 17.20% | 1.08% | 0.22% | NA |
| Indica III | 913 | 90.00% | 5.00% | 1.10% | 3.83% | NA |
| Indica Intermediate | 786 | 85.60% | 12.30% | 1.40% | 0.64% | NA |
| Temperate Japonica | 767 | 1.80% | 98.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.20% | 98.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 3.10% | 96.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 46.70% | 52.20% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0206770457 | A -> T | LOC_Os02g12840.1 | upstream_gene_variant ; 856.0bp to feature; MODIFIER | silent_mutation | Average:46.335; most accessible tissue: Callus, score: 90.172 | N | N | N | N |
| vg0206770457 | A -> T | LOC_Os02g12830-LOC_Os02g12840 | intergenic_region ; MODIFIER | silent_mutation | Average:46.335; most accessible tissue: Callus, score: 90.172 | N | N | N | N |
| vg0206770457 | A -> DEL | N | N | silent_mutation | Average:46.335; most accessible tissue: Callus, score: 90.172 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0206770457 | NA | 4.05E-09 | mr1047 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206770457 | NA | 5.72E-15 | mr1164 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206770457 | 1.44E-06 | 1.67E-08 | mr1195 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206770457 | NA | 1.46E-29 | mr1221 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206770457 | NA | 1.86E-14 | mr1261 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206770457 | NA | 3.41E-09 | mr1352 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206770457 | NA | 2.02E-42 | mr1458 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206770457 | NA | 1.98E-06 | mr1482 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206770457 | NA | 4.75E-23 | mr1571 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206770457 | NA | 6.31E-20 | mr1580 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206770457 | 8.55E-06 | 2.07E-07 | mr1614 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206770457 | NA | 6.88E-06 | mr1629 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206770457 | NA | 7.80E-09 | mr1769 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206770457 | NA | 1.39E-06 | mr1796 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206770457 | NA | 3.65E-17 | mr1825 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206770457 | NA | 4.25E-24 | mr1943 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206770457 | NA | 2.44E-55 | mr1109_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206770457 | NA | 5.86E-18 | mr1457_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206770457 | NA | 1.22E-46 | mr1458_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206770457 | NA | 3.10E-07 | mr1498_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206770457 | NA | 1.49E-30 | mr1932_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206770457 | NA | 5.63E-07 | mr1951_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |