\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0206663515:

Variant ID: vg0206663515 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 6663515
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACAGCAATGCCTTATGTGAACAATGGCGGATCAGAAAATTGATTCGTTGATGTCATAACGTGTGTATCGGTATCATAGTATGCTAATTATATTTAGATCA[T/C]
GGTGTTATAATATATGGATAAGCAGTTTTGCTATAGGTTTTGCCGAAAGTCATCGGTGTCGCCTGACACCGGTCCTTATATTGTAGATCCGCCCCTTTAA

Reverse complement sequence

TTAAAGGGGCGGATCTACAATATAAGGACCGGTGTCAGGCGACACCGATGACTTTCGGCAAAACCTATAGCAAAACTGCTTATCCATATATTATAACACC[A/G]
TGATCTAAATATAATTAGCATACTATGATACCGATACACACGTTATGACATCAACGAATCAATTTTCTGATCCGCCATTGTTCACATAAGGCATTGCTGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.80% 7.20% 0.00% 0.00% NA
All Indica  2759 97.60% 2.40% 0.00% 0.00% NA
All Japonica  1512 99.30% 0.70% 0.00% 0.00% NA
Aus  269 22.30% 77.70% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 97.50% 2.50% 0.00% 0.00% NA
Indica Intermediate  786 94.90% 5.10% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.00% 1.00% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 54.20% 45.80% 0.00% 0.00% NA
Intermediate  90 91.10% 8.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0206663515 T -> C LOC_Os02g12730.1 upstream_gene_variant ; 2531.0bp to feature; MODIFIER silent_mutation Average:71.884; most accessible tissue: Callus, score: 95.801 N N N N
vg0206663515 T -> C LOC_Os02g12730.3 upstream_gene_variant ; 2531.0bp to feature; MODIFIER silent_mutation Average:71.884; most accessible tissue: Callus, score: 95.801 N N N N
vg0206663515 T -> C LOC_Os02g12730.2 upstream_gene_variant ; 2891.0bp to feature; MODIFIER silent_mutation Average:71.884; most accessible tissue: Callus, score: 95.801 N N N N
vg0206663515 T -> C LOC_Os02g12730-LOC_Os02g12740 intergenic_region ; MODIFIER silent_mutation Average:71.884; most accessible tissue: Callus, score: 95.801 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0206663515 NA 1.27E-07 mr1415 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206663515 NA 1.27E-07 mr1567 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206663515 NA 3.41E-08 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206663515 8.87E-06 NA mr1087_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206663515 2.88E-07 NA mr1090_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206663515 NA 3.84E-08 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206663515 6.40E-07 NA mr1526_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206663515 NA 5.43E-09 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206663515 NA 6.76E-06 mr1735_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251