Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0206663515:

Variant ID: vg0206663515 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 6663515
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACAGCAATGCCTTATGTGAACAATGGCGGATCAGAAAATTGATTCGTTGATGTCATAACGTGTGTATCGGTATCATAGTATGCTAATTATATTTAGATCA[T/C]
GGTGTTATAATATATGGATAAGCAGTTTTGCTATAGGTTTTGCCGAAAGTCATCGGTGTCGCCTGACACCGGTCCTTATATTGTAGATCCGCCCCTTTAA

Reverse complement sequence

TTAAAGGGGCGGATCTACAATATAAGGACCGGTGTCAGGCGACACCGATGACTTTCGGCAAAACCTATAGCAAAACTGCTTATCCATATATTATAACACC[A/G]
TGATCTAAATATAATTAGCATACTATGATACCGATACACACGTTATGACATCAACGAATCAATTTTCTGATCCGCCATTGTTCACATAAGGCATTGCTGT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.80%	7.20%	0.00%	0.00%	NA
All Indica	2759	97.60%	2.40%	0.00%	0.00%	NA
All Japonica	1512	99.30%	0.70%	0.00%	0.00%	NA
Aus	269	22.30%	77.70%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.10%	0.90%	0.00%	0.00%	NA
Indica III	913	97.50%	2.50%	0.00%	0.00%	NA
Indica Intermediate	786	94.90%	5.10%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.00%	1.00%	0.00%	0.00%	NA
Japonica Intermediate	241	97.90%	2.10%	0.00%	0.00%	NA
VI/Aromatic	96	54.20%	45.80%	0.00%	0.00%	NA
Intermediate	90	91.10%	8.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0206663515	T -> C	LOC_Os02g12730.1	upstream_gene_variant ; 2531.0bp to feature; MODIFIER	silent_mutation	Average:71.884; most accessible tissue: Callus, score: 95.801	N	N	N	N
vg0206663515	T -> C	LOC_Os02g12730.3	upstream_gene_variant ; 2531.0bp to feature; MODIFIER	silent_mutation	Average:71.884; most accessible tissue: Callus, score: 95.801	N	N	N	N
vg0206663515	T -> C	LOC_Os02g12730.2	upstream_gene_variant ; 2891.0bp to feature; MODIFIER	silent_mutation	Average:71.884; most accessible tissue: Callus, score: 95.801	N	N	N	N
vg0206663515	T -> C	LOC_Os02g12730-LOC_Os02g12740	intergenic_region ; MODIFIER	silent_mutation	Average:71.884; most accessible tissue: Callus, score: 95.801	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0206663515	NA	1.27E-07	mr1415	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206663515	NA	1.27E-07	mr1567	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206663515	NA	3.41E-08	mr1570	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206663515	8.87E-06	NA	mr1087_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206663515	2.88E-07	NA	mr1090_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206663515	NA	3.84E-08	mr1126_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206663515	6.40E-07	NA	mr1526_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206663515	NA	5.43E-09	mr1567_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206663515	NA	6.76E-06	mr1735_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251