| Variant ID: vg0206663515 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 6663515 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
ACAGCAATGCCTTATGTGAACAATGGCGGATCAGAAAATTGATTCGTTGATGTCATAACGTGTGTATCGGTATCATAGTATGCTAATTATATTTAGATCA[T/C]
GGTGTTATAATATATGGATAAGCAGTTTTGCTATAGGTTTTGCCGAAAGTCATCGGTGTCGCCTGACACCGGTCCTTATATTGTAGATCCGCCCCTTTAA
TTAAAGGGGCGGATCTACAATATAAGGACCGGTGTCAGGCGACACCGATGACTTTCGGCAAAACCTATAGCAAAACTGCTTATCCATATATTATAACACC[A/G]
TGATCTAAATATAATTAGCATACTATGATACCGATACACACGTTATGACATCAACGAATCAATTTTCTGATCCGCCATTGTTCACATAAGGCATTGCTGT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.80% | 7.20% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 22.30% | 77.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.90% | 5.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 54.20% | 45.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0206663515 | T -> C | LOC_Os02g12730.1 | upstream_gene_variant ; 2531.0bp to feature; MODIFIER | silent_mutation | Average:71.884; most accessible tissue: Callus, score: 95.801 | N | N | N | N |
| vg0206663515 | T -> C | LOC_Os02g12730.3 | upstream_gene_variant ; 2531.0bp to feature; MODIFIER | silent_mutation | Average:71.884; most accessible tissue: Callus, score: 95.801 | N | N | N | N |
| vg0206663515 | T -> C | LOC_Os02g12730.2 | upstream_gene_variant ; 2891.0bp to feature; MODIFIER | silent_mutation | Average:71.884; most accessible tissue: Callus, score: 95.801 | N | N | N | N |
| vg0206663515 | T -> C | LOC_Os02g12730-LOC_Os02g12740 | intergenic_region ; MODIFIER | silent_mutation | Average:71.884; most accessible tissue: Callus, score: 95.801 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0206663515 | NA | 1.27E-07 | mr1415 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206663515 | NA | 1.27E-07 | mr1567 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206663515 | NA | 3.41E-08 | mr1570 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206663515 | 8.87E-06 | NA | mr1087_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206663515 | 2.88E-07 | NA | mr1090_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206663515 | NA | 3.84E-08 | mr1126_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206663515 | 6.40E-07 | NA | mr1526_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206663515 | NA | 5.43E-09 | mr1567_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206663515 | NA | 6.76E-06 | mr1735_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |