\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0206400695:

Variant ID: vg0206400695 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 6400695
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATGGATCAAGATCCATGGTTTTTTTCTTTTCACAACTTTACCTAAGCTCTCATATATTTTTAGGTCAAATACAAATTAAATTTTAGCACACCCTATTTT[G/A]
AACTCAGCCCTCAAATTTCGCAAATTTTAAAAGTTGGACCATTTATTAGCAACCTTAATTACCTGCGGGTACGAGTCGCTGGCGCCGAACAGCATGACGT

Reverse complement sequence

ACGTCATGCTGTTCGGCGCCAGCGACTCGTACCCGCAGGTAATTAAGGTTGCTAATAAATGGTCCAACTTTTAAAATTTGCGAAATTTGAGGGCTGAGTT[C/T]
AAAATAGGGTGTGCTAAAATTTAATTTGTATTTGACCTAAAAATATATGAGAGCTTAGGTAAAGTTGTGAAAAGAAAAAAACCATGGATCTTGATCCATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.60% 9.30% 0.02% 0.00% NA
All Indica  2759 90.80% 9.20% 0.00% 0.00% NA
All Japonica  1512 98.30% 1.70% 0.07% 0.00% NA
Aus  269 54.30% 45.70% 0.00% 0.00% NA
Indica I  595 90.80% 9.20% 0.00% 0.00% NA
Indica II  465 98.10% 1.90% 0.00% 0.00% NA
Indica III  913 89.30% 10.70% 0.00% 0.00% NA
Indica Intermediate  786 88.20% 11.80% 0.00% 0.00% NA
Temperate Japonica  767 99.60% 0.30% 0.13% 0.00% NA
Tropical Japonica  504 96.80% 3.20% 0.00% 0.00% NA
Japonica Intermediate  241 97.10% 2.90% 0.00% 0.00% NA
VI/Aromatic  96 69.80% 30.20% 0.00% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0206400695 G -> A LOC_Os02g12310.1 upstream_gene_variant ; 3323.0bp to feature; MODIFIER silent_mutation Average:73.89; most accessible tissue: Zhenshan97 root, score: 91.433 N N N N
vg0206400695 G -> A LOC_Os02g12290.1 downstream_gene_variant ; 1459.0bp to feature; MODIFIER silent_mutation Average:73.89; most accessible tissue: Zhenshan97 root, score: 91.433 N N N N
vg0206400695 G -> A LOC_Os02g12300.1 intron_variant ; MODIFIER silent_mutation Average:73.89; most accessible tissue: Zhenshan97 root, score: 91.433 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0206400695 G A 0.02 0.01 0.0 0.04 0.02 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0206400695 NA 3.81E-08 mr1004 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206400695 NA 1.05E-09 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206400695 NA 2.99E-07 mr1007 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206400695 NA 1.33E-09 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206400695 NA 6.69E-06 mr1052 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206400695 NA 2.48E-07 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206400695 2.80E-06 1.69E-11 mr1004_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206400695 NA 4.81E-06 mr1004_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206400695 NA 4.24E-07 mr1006_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206400695 NA 7.64E-06 mr1006_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206400695 NA 1.77E-06 mr1219_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251