| Variant ID: vg0206385095 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 6385095 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTGGACATGCATTATGAAATATCACATCTGGTTCTAGGTTGTTATATTATGAGACGGAAGGAGTAACTGAATTGAATGGTATTTTTCAGTTGACTAGACG[G/A]
TCCTTAATTTTTCACCCCATGTTACTATCTACCTATTGTCATAACGTGTTTTTCTTCACCGTTGATCAACCCAAAGCATTTGAATTGACTTGTTGGACGT
ACGTCCAACAAGTCAATTCAAATGCTTTGGGTTGATCAACGGTGAAGAAAAACACGTTATGACAATAGGTAGATAGTAACATGGGGTGAAAAATTAAGGA[C/T]
CGTCTAGTCAACTGAAAAATACCATTCAATTCAGTTACTCCTTCCGTCTCATAATATAACAACCTAGAACCAGATGTGATATTTCATAATGCATGTCCAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.00% | 7.50% | 1.10% | 4.46% | NA |
| All Indica | 2759 | 87.90% | 6.60% | 1.74% | 3.70% | NA |
| All Japonica | 1512 | 98.50% | 1.40% | 0.00% | 0.13% | NA |
| Aus | 269 | 29.70% | 44.60% | 0.74% | 24.91% | NA |
| Indica I | 595 | 91.60% | 5.70% | 2.18% | 0.50% | NA |
| Indica II | 465 | 86.50% | 2.20% | 2.37% | 9.03% | NA |
| Indica III | 913 | 89.20% | 7.20% | 0.88% | 2.74% | NA |
| Indica Intermediate | 786 | 84.60% | 9.30% | 2.04% | 4.07% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 96.80% | 3.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.10% | 2.10% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 40.60% | 21.90% | 2.08% | 35.42% | NA |
| Intermediate | 90 | 84.40% | 8.90% | 0.00% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0206385095 | G -> A | LOC_Os02g12260.1 | upstream_gene_variant ; 670.0bp to feature; MODIFIER | silent_mutation | Average:40.375; most accessible tissue: Zhenshan97 root, score: 88.778 | N | N | N | N |
| vg0206385095 | G -> A | LOC_Os02g12250.1 | downstream_gene_variant ; 2168.0bp to feature; MODIFIER | silent_mutation | Average:40.375; most accessible tissue: Zhenshan97 root, score: 88.778 | N | N | N | N |
| vg0206385095 | G -> A | LOC_Os02g12270.1 | downstream_gene_variant ; 2423.0bp to feature; MODIFIER | silent_mutation | Average:40.375; most accessible tissue: Zhenshan97 root, score: 88.778 | N | N | N | N |
| vg0206385095 | G -> A | LOC_Os02g12280.1 | downstream_gene_variant ; 4819.0bp to feature; MODIFIER | silent_mutation | Average:40.375; most accessible tissue: Zhenshan97 root, score: 88.778 | N | N | N | N |
| vg0206385095 | G -> A | LOC_Os02g12250-LOC_Os02g12260 | intergenic_region ; MODIFIER | silent_mutation | Average:40.375; most accessible tissue: Zhenshan97 root, score: 88.778 | N | N | N | N |
| vg0206385095 | G -> DEL | N | N | silent_mutation | Average:40.375; most accessible tissue: Zhenshan97 root, score: 88.778 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0206385095 | NA | 1.81E-09 | mr1004 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206385095 | NA | 2.50E-11 | mr1006 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206385095 | NA | 2.25E-08 | mr1007 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206385095 | NA | 5.19E-11 | mr1052 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206385095 | NA | 1.23E-06 | mr1073 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206385095 | NA | 2.10E-06 | mr1415 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206385095 | NA | 3.30E-14 | mr1496 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206385095 | NA | 2.10E-06 | mr1567 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206385095 | NA | 5.48E-06 | mr1774 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206385095 | NA | 2.92E-12 | mr1897 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206385095 | NA | 2.17E-09 | mr1004_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206385095 | NA | 1.36E-06 | mr1006_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206385095 | NA | 3.56E-06 | mr1219_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |