\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0206385095:

Variant ID: vg0206385095 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 6385095
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGGACATGCATTATGAAATATCACATCTGGTTCTAGGTTGTTATATTATGAGACGGAAGGAGTAACTGAATTGAATGGTATTTTTCAGTTGACTAGACG[G/A]
TCCTTAATTTTTCACCCCATGTTACTATCTACCTATTGTCATAACGTGTTTTTCTTCACCGTTGATCAACCCAAAGCATTTGAATTGACTTGTTGGACGT

Reverse complement sequence

ACGTCCAACAAGTCAATTCAAATGCTTTGGGTTGATCAACGGTGAAGAAAAACACGTTATGACAATAGGTAGATAGTAACATGGGGTGAAAAATTAAGGA[C/T]
CGTCTAGTCAACTGAAAAATACCATTCAATTCAGTTACTCCTTCCGTCTCATAATATAACAACCTAGAACCAGATGTGATATTTCATAATGCATGTCCAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.00% 7.50% 1.10% 4.46% NA
All Indica  2759 87.90% 6.60% 1.74% 3.70% NA
All Japonica  1512 98.50% 1.40% 0.00% 0.13% NA
Aus  269 29.70% 44.60% 0.74% 24.91% NA
Indica I  595 91.60% 5.70% 2.18% 0.50% NA
Indica II  465 86.50% 2.20% 2.37% 9.03% NA
Indica III  913 89.20% 7.20% 0.88% 2.74% NA
Indica Intermediate  786 84.60% 9.30% 2.04% 4.07% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 96.80% 3.20% 0.00% 0.00% NA
Japonica Intermediate  241 97.10% 2.10% 0.00% 0.83% NA
VI/Aromatic  96 40.60% 21.90% 2.08% 35.42% NA
Intermediate  90 84.40% 8.90% 0.00% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0206385095 G -> A LOC_Os02g12260.1 upstream_gene_variant ; 670.0bp to feature; MODIFIER silent_mutation Average:40.375; most accessible tissue: Zhenshan97 root, score: 88.778 N N N N
vg0206385095 G -> A LOC_Os02g12250.1 downstream_gene_variant ; 2168.0bp to feature; MODIFIER silent_mutation Average:40.375; most accessible tissue: Zhenshan97 root, score: 88.778 N N N N
vg0206385095 G -> A LOC_Os02g12270.1 downstream_gene_variant ; 2423.0bp to feature; MODIFIER silent_mutation Average:40.375; most accessible tissue: Zhenshan97 root, score: 88.778 N N N N
vg0206385095 G -> A LOC_Os02g12280.1 downstream_gene_variant ; 4819.0bp to feature; MODIFIER silent_mutation Average:40.375; most accessible tissue: Zhenshan97 root, score: 88.778 N N N N
vg0206385095 G -> A LOC_Os02g12250-LOC_Os02g12260 intergenic_region ; MODIFIER silent_mutation Average:40.375; most accessible tissue: Zhenshan97 root, score: 88.778 N N N N
vg0206385095 G -> DEL N N silent_mutation Average:40.375; most accessible tissue: Zhenshan97 root, score: 88.778 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0206385095 NA 1.81E-09 mr1004 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206385095 NA 2.50E-11 mr1006 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206385095 NA 2.25E-08 mr1007 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206385095 NA 5.19E-11 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206385095 NA 1.23E-06 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206385095 NA 2.10E-06 mr1415 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206385095 NA 3.30E-14 mr1496 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206385095 NA 2.10E-06 mr1567 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206385095 NA 5.48E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206385095 NA 2.92E-12 mr1897 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206385095 NA 2.17E-09 mr1004_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206385095 NA 1.36E-06 mr1006_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206385095 NA 3.56E-06 mr1219_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251