\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0206372400:

Variant ID: vg0206372400 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 6372400
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGCGGTGGCTGCAGCGACAAGAGGAGAACGGCACGTTGCCAGGCTCTCGAGCTCACCCCTCATCAGTGATCCGTTCTTCGCTCAACCTCGCTGTTGTCGC[A/G]
GGCTCCAAACCTAGATGACGGTACAAATCCAGTGGAGCTCTTGCTGCTCGTCACCTCTCAGGTCGGTCCCCTCTCCCTCAGGTAACTGATGTACTTAAGG

Reverse complement sequence

CCTTAAGTACATCAGTTACCTGAGGGAGAGGGGACCGACCTGAGAGGTGACGAGCAGCAAGAGCTCCACTGGATTTGTACCGTCATCTAGGTTTGGAGCC[T/C]
GCGACAACAGCGAGGTTGAGCGAAGAACGGATCACTGATGAGGGGTGAGCTCGAGAGCCTGGCAACGTGCCGTTCTCCTCTTGTCGCTGCAGCCACCGCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.30% 34.70% 1.40% 3.62% NA
All Indica  2759 87.80% 4.10% 2.14% 5.98% NA
All Japonica  1512 3.50% 96.40% 0.13% 0.00% NA
Aus  269 96.70% 1.90% 0.37% 1.12% NA
Indica I  595 85.00% 7.60% 3.70% 3.70% NA
Indica II  465 88.20% 2.40% 2.37% 7.10% NA
Indica III  913 90.80% 1.50% 0.66% 7.01% NA
Indica Intermediate  786 86.30% 5.30% 2.54% 5.85% NA
Temperate Japonica  767 2.60% 97.30% 0.13% 0.00% NA
Tropical Japonica  504 4.20% 95.80% 0.00% 0.00% NA
Japonica Intermediate  241 5.00% 94.60% 0.41% 0.00% NA
VI/Aromatic  96 71.90% 27.10% 0.00% 1.04% NA
Intermediate  90 47.80% 45.60% 4.44% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0206372400 A -> G LOC_Os02g12220.1 upstream_gene_variant ; 2866.0bp to feature; MODIFIER silent_mutation Average:18.747; most accessible tissue: Callus, score: 51.898 N N N N
vg0206372400 A -> G LOC_Os02g12230.1 upstream_gene_variant ; 2229.0bp to feature; MODIFIER silent_mutation Average:18.747; most accessible tissue: Callus, score: 51.898 N N N N
vg0206372400 A -> G LOC_Os02g12240.1 upstream_gene_variant ; 4117.0bp to feature; MODIFIER silent_mutation Average:18.747; most accessible tissue: Callus, score: 51.898 N N N N
vg0206372400 A -> G LOC_Os02g12220-LOC_Os02g12230 intergenic_region ; MODIFIER silent_mutation Average:18.747; most accessible tissue: Callus, score: 51.898 N N N N
vg0206372400 A -> DEL N N silent_mutation Average:18.747; most accessible tissue: Callus, score: 51.898 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0206372400 8.98E-07 NA mr1088 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372400 NA 7.67E-49 mr1136 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372400 NA 1.67E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372400 NA 9.94E-34 mr1448 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372400 NA 4.88E-40 mr1480 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372400 NA 5.31E-20 mr1588 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372400 NA 3.04E-44 mr1591 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372400 2.16E-06 6.33E-51 mr1599 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372400 NA 1.61E-49 mr1692 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372400 NA 1.13E-34 mr1828 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372400 NA 9.41E-40 mr1890 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372400 NA 2.67E-40 mr1891 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372400 NA 1.01E-09 mr1905 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372400 NA 2.05E-54 mr1136_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372400 NA 5.79E-09 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372400 NA 1.34E-17 mr1416_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251