Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0206372400:

Variant ID: vg0206372400 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 6372400
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGCGGTGGCTGCAGCGACAAGAGGAGAACGGCACGTTGCCAGGCTCTCGAGCTCACCCCTCATCAGTGATCCGTTCTTCGCTCAACCTCGCTGTTGTCGC[A/G]
GGCTCCAAACCTAGATGACGGTACAAATCCAGTGGAGCTCTTGCTGCTCGTCACCTCTCAGGTCGGTCCCCTCTCCCTCAGGTAACTGATGTACTTAAGG

Reverse complement sequence

CCTTAAGTACATCAGTTACCTGAGGGAGAGGGGACCGACCTGAGAGGTGACGAGCAGCAAGAGCTCCACTGGATTTGTACCGTCATCTAGGTTTGGAGCC[T/C]
GCGACAACAGCGAGGTTGAGCGAAGAACGGATCACTGATGAGGGGTGAGCTCGAGAGCCTGGCAACGTGCCGTTCTCCTCTTGTCGCTGCAGCCACCGCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.30%	34.70%	1.40%	3.62%	NA
All Indica	2759	87.80%	4.10%	2.14%	5.98%	NA
All Japonica	1512	3.50%	96.40%	0.13%	0.00%	NA
Aus	269	96.70%	1.90%	0.37%	1.12%	NA
Indica I	595	85.00%	7.60%	3.70%	3.70%	NA
Indica II	465	88.20%	2.40%	2.37%	7.10%	NA
Indica III	913	90.80%	1.50%	0.66%	7.01%	NA
Indica Intermediate	786	86.30%	5.30%	2.54%	5.85%	NA
Temperate Japonica	767	2.60%	97.30%	0.13%	0.00%	NA
Tropical Japonica	504	4.20%	95.80%	0.00%	0.00%	NA
Japonica Intermediate	241	5.00%	94.60%	0.41%	0.00%	NA
VI/Aromatic	96	71.90%	27.10%	0.00%	1.04%	NA
Intermediate	90	47.80%	45.60%	4.44%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0206372400	A -> G	LOC_Os02g12220.1	upstream_gene_variant ; 2866.0bp to feature; MODIFIER	silent_mutation	Average:18.747; most accessible tissue: Callus, score: 51.898	N	N	N	N
vg0206372400	A -> G	LOC_Os02g12230.1	upstream_gene_variant ; 2229.0bp to feature; MODIFIER	silent_mutation	Average:18.747; most accessible tissue: Callus, score: 51.898	N	N	N	N
vg0206372400	A -> G	LOC_Os02g12240.1	upstream_gene_variant ; 4117.0bp to feature; MODIFIER	silent_mutation	Average:18.747; most accessible tissue: Callus, score: 51.898	N	N	N	N
vg0206372400	A -> G	LOC_Os02g12220-LOC_Os02g12230	intergenic_region ; MODIFIER	silent_mutation	Average:18.747; most accessible tissue: Callus, score: 51.898	N	N	N	N
vg0206372400	A -> DEL	N	N	silent_mutation	Average:18.747; most accessible tissue: Callus, score: 51.898	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0206372400	8.98E-07	NA	mr1088	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372400	NA	7.67E-49	mr1136	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372400	NA	1.67E-07	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372400	NA	9.94E-34	mr1448	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372400	NA	4.88E-40	mr1480	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372400	NA	5.31E-20	mr1588	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372400	NA	3.04E-44	mr1591	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372400	2.16E-06	6.33E-51	mr1599	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372400	NA	1.61E-49	mr1692	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372400	NA	1.13E-34	mr1828	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372400	NA	9.41E-40	mr1890	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372400	NA	2.67E-40	mr1891	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372400	NA	1.01E-09	mr1905	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372400	NA	2.05E-54	mr1136_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372400	NA	5.79E-09	mr1379_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372400	NA	1.34E-17	mr1416_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251