\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0206319805:

Variant ID: vg0206319805 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 6319805
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACTTCAATCTTCTATCAAATTGTAATTGGGGGAAAATCCAAATACCCCTACAAGTCACTAGTATTTTCAGTCTCTTCTTATAATTTAATTTCGTGCACTC[C/A]
TATTTTTTTCAACTTTCCACCTCTATCTATTTTTCTCATGATCCATGGACCTCCATCACGGTGTGCAAACTGCAAAGTTGTCCCTTTAAACCAAAGTTGT

Reverse complement sequence

ACAACTTTGGTTTAAAGGGACAACTTTGCAGTTTGCACACCGTGATGGAGGTCCATGGATCATGAGAAAAATAGATAGAGGTGGAAAGTTGAAAAAAATA[G/T]
GAGTGCACGAAATTAAATTATAAGAAGAGACTGAAAATACTAGTGACTTGTAGGGGTATTTGGATTTTCCCCCAATTACAATTTGATAGAAGATTGAAGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.80% 4.10% 1.46% 55.63% NA
All Indica  2759 5.80% 1.90% 2.32% 89.92% NA
All Japonica  1512 97.60% 0.30% 0.07% 1.98% NA
Aus  269 29.00% 45.40% 0.37% 25.28% NA
Indica I  595 3.50% 0.00% 1.51% 94.96% NA
Indica II  465 11.00% 0.40% 1.72% 86.88% NA
Indica III  913 3.90% 2.00% 3.29% 90.80% NA
Indica Intermediate  786 6.70% 4.20% 2.16% 86.90% NA
Temperate Japonica  767 97.40% 0.00% 0.00% 2.61% NA
Tropical Japonica  504 98.60% 0.60% 0.00% 0.79% NA
Japonica Intermediate  241 96.30% 0.80% 0.41% 2.49% NA
VI/Aromatic  96 74.00% 9.40% 2.08% 14.58% NA
Intermediate  90 51.10% 7.80% 1.11% 40.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0206319805 C -> A LOC_Os02g12140.1 upstream_gene_variant ; 1743.0bp to feature; MODIFIER silent_mutation Average:15.357; most accessible tissue: Callus, score: 79.409 N N N N
vg0206319805 C -> A LOC_Os02g12150.1 downstream_gene_variant ; 1340.0bp to feature; MODIFIER silent_mutation Average:15.357; most accessible tissue: Callus, score: 79.409 N N N N
vg0206319805 C -> A LOC_Os02g12140-LOC_Os02g12150 intergenic_region ; MODIFIER silent_mutation Average:15.357; most accessible tissue: Callus, score: 79.409 N N N N
vg0206319805 C -> DEL N N silent_mutation Average:15.357; most accessible tissue: Callus, score: 79.409 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0206319805 NA 1.64E-07 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206319805 NA 1.81E-07 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206319805 NA 1.64E-14 mr1166 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206319805 NA 2.98E-06 mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206319805 NA 6.44E-07 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206319805 NA 4.02E-10 mr1232 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206319805 NA 8.68E-07 mr1283 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206319805 NA 2.38E-07 mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206319805 NA 3.26E-06 mr1288 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206319805 NA 2.72E-10 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206319805 NA 1.27E-07 mr1312 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206319805 NA 9.65E-06 mr1351 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206319805 NA 1.15E-06 mr1417 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206319805 NA 4.60E-07 mr1512 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206319805 NA 2.38E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206319805 NA 5.38E-10 mr1608 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206319805 NA 2.47E-13 mr1612 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206319805 NA 5.91E-12 mr1649 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206319805 NA 6.81E-06 mr1687 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206319805 NA 3.12E-06 mr1759 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206319805 NA 2.30E-09 mr1762 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206319805 NA 1.48E-16 mr1765 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206319805 9.86E-06 5.53E-10 mr1774 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206319805 NA 1.74E-07 mr1777 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206319805 NA 4.41E-13 mr1897 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206319805 NA 2.17E-06 mr1985 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206319805 NA 1.51E-06 mr1988 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251