Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0206319805:

Variant ID: vg0206319805 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 6319805
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACTTCAATCTTCTATCAAATTGTAATTGGGGGAAAATCCAAATACCCCTACAAGTCACTAGTATTTTCAGTCTCTTCTTATAATTTAATTTCGTGCACTC[C/A]
TATTTTTTTCAACTTTCCACCTCTATCTATTTTTCTCATGATCCATGGACCTCCATCACGGTGTGCAAACTGCAAAGTTGTCCCTTTAAACCAAAGTTGT

Reverse complement sequence

ACAACTTTGGTTTAAAGGGACAACTTTGCAGTTTGCACACCGTGATGGAGGTCCATGGATCATGAGAAAAATAGATAGAGGTGGAAAGTTGAAAAAAATA[G/T]
GAGTGCACGAAATTAAATTATAAGAAGAGACTGAAAATACTAGTGACTTGTAGGGGTATTTGGATTTTCCCCCAATTACAATTTGATAGAAGATTGAAGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	38.80%	4.10%	1.46%	55.63%	NA
All Indica	2759	5.80%	1.90%	2.32%	89.92%	NA
All Japonica	1512	97.60%	0.30%	0.07%	1.98%	NA
Aus	269	29.00%	45.40%	0.37%	25.28%	NA
Indica I	595	3.50%	0.00%	1.51%	94.96%	NA
Indica II	465	11.00%	0.40%	1.72%	86.88%	NA
Indica III	913	3.90%	2.00%	3.29%	90.80%	NA
Indica Intermediate	786	6.70%	4.20%	2.16%	86.90%	NA
Temperate Japonica	767	97.40%	0.00%	0.00%	2.61%	NA
Tropical Japonica	504	98.60%	0.60%	0.00%	0.79%	NA
Japonica Intermediate	241	96.30%	0.80%	0.41%	2.49%	NA
VI/Aromatic	96	74.00%	9.40%	2.08%	14.58%	NA
Intermediate	90	51.10%	7.80%	1.11%	40.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0206319805	C -> A	LOC_Os02g12140.1	upstream_gene_variant ; 1743.0bp to feature; MODIFIER	silent_mutation	Average:15.357; most accessible tissue: Callus, score: 79.409	N	N	N	N
vg0206319805	C -> A	LOC_Os02g12150.1	downstream_gene_variant ; 1340.0bp to feature; MODIFIER	silent_mutation	Average:15.357; most accessible tissue: Callus, score: 79.409	N	N	N	N
vg0206319805	C -> A	LOC_Os02g12140-LOC_Os02g12150	intergenic_region ; MODIFIER	silent_mutation	Average:15.357; most accessible tissue: Callus, score: 79.409	N	N	N	N
vg0206319805	C -> DEL	N	N	silent_mutation	Average:15.357; most accessible tissue: Callus, score: 79.409	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0206319805	NA	1.64E-07	mr1058	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206319805	NA	1.81E-07	mr1073	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206319805	NA	1.64E-14	mr1166	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206319805	NA	2.98E-06	mr1207	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206319805	NA	6.44E-07	mr1229	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206319805	NA	4.02E-10	mr1232	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206319805	NA	8.68E-07	mr1283	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206319805	NA	2.38E-07	mr1286	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206319805	NA	3.26E-06	mr1288	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206319805	NA	2.72E-10	mr1307	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206319805	NA	1.27E-07	mr1312	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206319805	NA	9.65E-06	mr1351	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206319805	NA	1.15E-06	mr1417	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206319805	NA	4.60E-07	mr1512	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206319805	NA	2.38E-06	mr1596	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206319805	NA	5.38E-10	mr1608	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206319805	NA	2.47E-13	mr1612	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206319805	NA	5.91E-12	mr1649	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206319805	NA	6.81E-06	mr1687	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206319805	NA	3.12E-06	mr1759	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206319805	NA	2.30E-09	mr1762	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206319805	NA	1.48E-16	mr1765	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206319805	9.86E-06	5.53E-10	mr1774	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206319805	NA	1.74E-07	mr1777	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206319805	NA	4.41E-13	mr1897	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206319805	NA	2.17E-06	mr1985	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206319805	NA	1.51E-06	mr1988	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251