\
| Variant ID: vg0206101296 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 6101296 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GGCTAGAAAACTTAGCCCCCACACTTGGCGAGGAAACGTTCATGTAGATGAGAAAGAGGTTGGGCTCTTACCACCGAGGAAGCAAACGAATGCGCAATAC[A/G]
CGAGCGTCACAGGGCCATGAGAAAAGAATGGGGGAAAAGAAATATAAGACTTCAAGCTGTATTAAGCTGATGAATTGAAAAATTGAAAATACTTGAAGGT
ACCTTCAAGTATTTTCAATTTTTCAATTCATCAGCTTAATACAGCTTGAAGTCTTATATTTCTTTTCCCCCATTCTTTTCTCATGGCCCTGTGACGCTCG[T/C]
GTATTGCGCATTCGTTTGCTTCCTCGGTGGTAAGAGCCCAACCTCTTTCTCATCTACATGAACGTTTCCTCGCCAAGTGTGGGGGCTAAGTTTTCTAGCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.70% | 31.30% | 0.83% | 29.24% | NA |
| All Indica | 2759 | 51.60% | 1.10% | 1.41% | 45.89% | NA |
| All Japonica | 1512 | 2.90% | 91.90% | 0.00% | 5.16% | NA |
| Aus | 269 | 98.90% | 0.70% | 0.00% | 0.37% | NA |
| Indica I | 595 | 56.50% | 0.70% | 1.51% | 41.34% | NA |
| Indica II | 465 | 62.80% | 0.60% | 0.65% | 35.91% | NA |
| Indica III | 913 | 42.60% | 1.00% | 1.64% | 54.76% | NA |
| Indica Intermediate | 786 | 51.90% | 1.70% | 1.53% | 44.91% | NA |
| Temperate Japonica | 767 | 1.80% | 89.00% | 0.00% | 9.13% | NA |
| Tropical Japonica | 504 | 4.00% | 95.40% | 0.00% | 0.60% | NA |
| Japonica Intermediate | 241 | 4.10% | 93.80% | 0.00% | 2.07% | NA |
| VI/Aromatic | 96 | 56.20% | 19.80% | 0.00% | 23.96% | NA |
| Intermediate | 90 | 43.30% | 41.10% | 0.00% | 15.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0206101296 | A -> G | LOC_Os02g11800.1 | downstream_gene_variant ; 3367.0bp to feature; MODIFIER | silent_mutation | Average:26.144; most accessible tissue: Minghui63 root, score: 56.226 | N | N | N | N |
| vg0206101296 | A -> G | LOC_Os02g11790-LOC_Os02g11800 | intergenic_region ; MODIFIER | silent_mutation | Average:26.144; most accessible tissue: Minghui63 root, score: 56.226 | N | N | N | N |
| vg0206101296 | A -> DEL | N | N | silent_mutation | Average:26.144; most accessible tissue: Minghui63 root, score: 56.226 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0206101296 | NA | 3.92E-06 | mr1291 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206101296 | NA | 9.07E-23 | mr1383 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206101296 | NA | 1.27E-19 | mr1557 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206101296 | NA | 8.89E-14 | mr1641 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206101296 | NA | 3.49E-06 | mr1646 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206101296 | NA | 9.71E-17 | mr1653 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206101296 | NA | 7.05E-21 | mr1715 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206101296 | NA | 9.87E-07 | mr1815 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206101296 | NA | 2.03E-34 | mr1944 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206101296 | NA | 4.52E-07 | mr1358_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206101296 | NA | 7.46E-10 | mr1379_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206101296 | NA | 3.56E-06 | mr1559_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206101296 | NA | 3.21E-09 | mr1576_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206101296 | NA | 1.17E-08 | mr1749_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206101296 | NA | 8.66E-09 | mr1821_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |