Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0205952749:

Variant ID: vg0205952749 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 5952749
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.62, G: 0.38, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:

CCATTGGCTAGATCCAGACAGCGACCTCGGTCAATCCTTCAAGGACATTAATGTCAGCAATGCGAAGGATGCTTGGAATGTACTCCCTCCATCCCAAAAT[A/G]
TTTGATGCCGTTGATTTTTTAAAAAATATTTGACCGTTCGTCTTATTAAAATAAACTTAAGTAATTATTAATTCTTTTCCTATCATTTAATTTATTATTA

Reverse complement sequence

TAATAATAAATTAAATGATAGGAAAAGAATTAATAATTACTTAAGTTTATTTTAATAAGACGAACGGTCAAATATTTTTTAAAAAATCAACGGCATCAAA[T/C]
ATTTTGGGATGGAGGGAGTACATTCCAAGCATCCTTCGCATTGCTGACATTAATGTCCTTGAAGGATTGACCGAGGTCGCTGTCTGGATCTAGCCAATGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.90%	40.10%	0.04%	0.00%	NA
All Indica	2759	87.10%	12.80%	0.07%	0.00%	NA
All Japonica	1512	3.20%	96.80%	0.00%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	65.90%	33.90%	0.17%	0.00%	NA
Indica II	465	89.00%	11.00%	0.00%	0.00%	NA
Indica III	913	98.00%	1.90%	0.11%	0.00%	NA
Indica Intermediate	786	89.40%	10.60%	0.00%	0.00%	NA
Temperate Japonica	767	2.10%	97.90%	0.00%	0.00%	NA
Tropical Japonica	504	3.80%	96.20%	0.00%	0.00%	NA
Japonica Intermediate	241	5.40%	94.60%	0.00%	0.00%	NA
VI/Aromatic	96	62.50%	37.50%	0.00%	0.00%	NA
Intermediate	90	56.70%	43.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0205952749	A -> G	LOC_Os02g11100.1	downstream_gene_variant ; 50.0bp to feature; MODIFIER	silent_mutation	Average:71.314; most accessible tissue: Callus, score: 84.021	N	N	N	N
vg0205952749	A -> G	LOC_Os02g11110.1	downstream_gene_variant ; 2251.0bp to feature; MODIFIER	silent_mutation	Average:71.314; most accessible tissue: Callus, score: 84.021	N	N	N	N
vg0205952749	A -> G	LOC_Os02g11110.2	downstream_gene_variant ; 2681.0bp to feature; MODIFIER	silent_mutation	Average:71.314; most accessible tissue: Callus, score: 84.021	N	N	N	N
vg0205952749	A -> G	LOC_Os02g11100-LOC_Os02g11110	intergenic_region ; MODIFIER	silent_mutation	Average:71.314; most accessible tissue: Callus, score: 84.021	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0205952749	NA	1.79E-16	mr1170	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205952749	NA	7.90E-06	mr1170	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205952749	2.58E-07	8.41E-15	mr1714	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205952749	9.51E-06	9.51E-06	mr1714	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205952749	NA	2.64E-11	mr1170_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205952749	NA	9.33E-17	mr1557_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205952749	9.71E-07	1.77E-15	mr1714_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251