Variant ID: vg0205952749 (JBrowse) | Variation Type: SNP |
Chromosome: chr02 | Position: 5952749 |
Reference Allele: A | Alternative Allele: G |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.62, G: 0.38, others allele: 0.00, population size: 100. )
CCATTGGCTAGATCCAGACAGCGACCTCGGTCAATCCTTCAAGGACATTAATGTCAGCAATGCGAAGGATGCTTGGAATGTACTCCCTCCATCCCAAAAT[A/G]
TTTGATGCCGTTGATTTTTTAAAAAATATTTGACCGTTCGTCTTATTAAAATAAACTTAAGTAATTATTAATTCTTTTCCTATCATTTAATTTATTATTA
TAATAATAAATTAAATGATAGGAAAAGAATTAATAATTACTTAAGTTTATTTTAATAAGACGAACGGTCAAATATTTTTTAAAAAATCAACGGCATCAAA[T/C]
ATTTTGGGATGGAGGGAGTACATTCCAAGCATCCTTCGCATTGCTGACATTAATGTCCTTGAAGGATTGACCGAGGTCGCTGTCTGGATCTAGCCAATGG
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 59.90% | 40.10% | 0.04% | 0.00% | NA |
All Indica | 2759 | 87.10% | 12.80% | 0.07% | 0.00% | NA |
All Japonica | 1512 | 3.20% | 96.80% | 0.00% | 0.00% | NA |
Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
Indica I | 595 | 65.90% | 33.90% | 0.17% | 0.00% | NA |
Indica II | 465 | 89.00% | 11.00% | 0.00% | 0.00% | NA |
Indica III | 913 | 98.00% | 1.90% | 0.11% | 0.00% | NA |
Indica Intermediate | 786 | 89.40% | 10.60% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 3.80% | 96.20% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 5.40% | 94.60% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 62.50% | 37.50% | 0.00% | 0.00% | NA |
Intermediate | 90 | 56.70% | 43.30% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0205952749 | A -> G | LOC_Os02g11100.1 | downstream_gene_variant ; 50.0bp to feature; MODIFIER | silent_mutation | Average:71.314; most accessible tissue: Callus, score: 84.021 | N | N | N | N |
vg0205952749 | A -> G | LOC_Os02g11110.1 | downstream_gene_variant ; 2251.0bp to feature; MODIFIER | silent_mutation | Average:71.314; most accessible tissue: Callus, score: 84.021 | N | N | N | N |
vg0205952749 | A -> G | LOC_Os02g11110.2 | downstream_gene_variant ; 2681.0bp to feature; MODIFIER | silent_mutation | Average:71.314; most accessible tissue: Callus, score: 84.021 | N | N | N | N |
vg0205952749 | A -> G | LOC_Os02g11100-LOC_Os02g11110 | intergenic_region ; MODIFIER | silent_mutation | Average:71.314; most accessible tissue: Callus, score: 84.021 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0205952749 | NA | 1.79E-16 | mr1170 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0205952749 | NA | 7.90E-06 | mr1170 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0205952749 | 2.58E-07 | 8.41E-15 | mr1714 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0205952749 | 9.51E-06 | 9.51E-06 | mr1714 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0205952749 | NA | 2.64E-11 | mr1170_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0205952749 | NA | 9.33E-17 | mr1557_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0205952749 | 9.71E-07 | 1.77E-15 | mr1714_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |