\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0205952749:

Variant ID: vg0205952749 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 5952749
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.62, G: 0.38, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


CCATTGGCTAGATCCAGACAGCGACCTCGGTCAATCCTTCAAGGACATTAATGTCAGCAATGCGAAGGATGCTTGGAATGTACTCCCTCCATCCCAAAAT[A/G]
TTTGATGCCGTTGATTTTTTAAAAAATATTTGACCGTTCGTCTTATTAAAATAAACTTAAGTAATTATTAATTCTTTTCCTATCATTTAATTTATTATTA

Reverse complement sequence

TAATAATAAATTAAATGATAGGAAAAGAATTAATAATTACTTAAGTTTATTTTAATAAGACGAACGGTCAAATATTTTTTAAAAAATCAACGGCATCAAA[T/C]
ATTTTGGGATGGAGGGAGTACATTCCAAGCATCCTTCGCATTGCTGACATTAATGTCCTTGAAGGATTGACCGAGGTCGCTGTCTGGATCTAGCCAATGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.90% 40.10% 0.04% 0.00% NA
All Indica  2759 87.10% 12.80% 0.07% 0.00% NA
All Japonica  1512 3.20% 96.80% 0.00% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 65.90% 33.90% 0.17% 0.00% NA
Indica II  465 89.00% 11.00% 0.00% 0.00% NA
Indica III  913 98.00% 1.90% 0.11% 0.00% NA
Indica Intermediate  786 89.40% 10.60% 0.00% 0.00% NA
Temperate Japonica  767 2.10% 97.90% 0.00% 0.00% NA
Tropical Japonica  504 3.80% 96.20% 0.00% 0.00% NA
Japonica Intermediate  241 5.40% 94.60% 0.00% 0.00% NA
VI/Aromatic  96 62.50% 37.50% 0.00% 0.00% NA
Intermediate  90 56.70% 43.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0205952749 A -> G LOC_Os02g11100.1 downstream_gene_variant ; 50.0bp to feature; MODIFIER silent_mutation Average:71.314; most accessible tissue: Callus, score: 84.021 N N N N
vg0205952749 A -> G LOC_Os02g11110.1 downstream_gene_variant ; 2251.0bp to feature; MODIFIER silent_mutation Average:71.314; most accessible tissue: Callus, score: 84.021 N N N N
vg0205952749 A -> G LOC_Os02g11110.2 downstream_gene_variant ; 2681.0bp to feature; MODIFIER silent_mutation Average:71.314; most accessible tissue: Callus, score: 84.021 N N N N
vg0205952749 A -> G LOC_Os02g11100-LOC_Os02g11110 intergenic_region ; MODIFIER silent_mutation Average:71.314; most accessible tissue: Callus, score: 84.021 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0205952749 NA 1.79E-16 mr1170 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205952749 NA 7.90E-06 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205952749 2.58E-07 8.41E-15 mr1714 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205952749 9.51E-06 9.51E-06 mr1714 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205952749 NA 2.64E-11 mr1170_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205952749 NA 9.33E-17 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205952749 9.71E-07 1.77E-15 mr1714_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251