Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0205950133:

Variant ID: vg0205950133 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 5950133
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, A: 0.02, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:

GGTTGGTGTTATCAACCGGGACTAAAGAGAGGGGATCTTTAGTCCTGGTTGATAACACCAACCGGGACTAAAAAGAGGGAAGCGACAGTGAGATGGTCCC[C/A]
TTTTCTTTTTTTTTCTTTTTTATTTTCTCCCGAATCGAGTGGGATATATATCTCAAATCAAACCCAAATCCCCAAATCAAAATAACATCCCAAATCTTAA

Reverse complement sequence

TTAAGATTTGGGATGTTATTTTGATTTGGGGATTTGGGTTTGATTTGAGATATATATCCCACTCGATTCGGGAGAAAATAAAAAAGAAAAAAAAAGAAAA[G/T]
GGGACCATCTCACTGTCGCTTCCCTCTTTTTAGTCCCGGTTGGTGTTATCAACCAGGACTAAAGATCCCCTCTCTTTAGTCCCGGTTGATAACACCAACC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.30%	16.60%	6.90%	0.25%	NA
All Indica	2759	71.60%	16.70%	11.27%	0.43%	NA
All Japonica	1512	98.90%	0.90%	0.13%	0.00%	NA
Aus	269	8.90%	90.70%	0.37%	0.00%	NA
Indica I	595	86.40%	0.70%	12.61%	0.34%	NA
Indica II	465	62.60%	27.10%	10.11%	0.22%	NA
Indica III	913	71.60%	18.30%	9.75%	0.33%	NA
Indica Intermediate	786	65.80%	20.70%	12.72%	0.76%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	98.40%	1.60%	0.00%	0.00%	NA
Japonica Intermediate	241	97.50%	1.70%	0.83%	0.00%	NA
VI/Aromatic	96	43.80%	52.10%	4.17%	0.00%	NA
Intermediate	90	74.40%	16.70%	8.89%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0205950133	C -> A	LOC_Os02g11100.1	upstream_gene_variant ; 2186.0bp to feature; MODIFIER	silent_mutation	Average:38.663; most accessible tissue: Zhenshan97 panicle, score: 63.607	N	N	N	N
vg0205950133	C -> A	LOC_Os02g11090.1	downstream_gene_variant ; 3810.0bp to feature; MODIFIER	silent_mutation	Average:38.663; most accessible tissue: Zhenshan97 panicle, score: 63.607	N	N	N	N
vg0205950133	C -> A	LOC_Os02g11110.1	downstream_gene_variant ; 4867.0bp to feature; MODIFIER	silent_mutation	Average:38.663; most accessible tissue: Zhenshan97 panicle, score: 63.607	N	N	N	N
vg0205950133	C -> A	LOC_Os02g11090-LOC_Os02g11100	intergenic_region ; MODIFIER	silent_mutation	Average:38.663; most accessible tissue: Zhenshan97 panicle, score: 63.607	N	N	N	N
vg0205950133	C -> DEL	N	N	silent_mutation	Average:38.663; most accessible tissue: Zhenshan97 panicle, score: 63.607	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0205950133	NA	4.67E-13	mr1231	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205950133	NA	1.39E-11	mr1232	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205950133	NA	4.71E-07	mr1410	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205950133	NA	1.37E-18	mr1557	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205950133	8.93E-06	8.77E-11	mr1004_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205950133	NA	6.30E-11	mr1166_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205950133	NA	6.30E-12	mr1232_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205950133	NA	7.59E-19	mr1557_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205950133	NA	2.12E-09	mr1557_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205950133	NA	4.45E-07	mr1567_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205950133	NA	2.37E-07	mr1582_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205950133	NA	3.35E-09	mr1609_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205950133	NA	3.93E-07	mr1735_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205950133	NA	1.42E-08	mr1762_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205950133	NA	4.64E-08	mr1765_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205950133	NA	3.23E-08	mr1805_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205950133	NA	2.03E-13	mr1846_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205950133	NA	3.24E-08	mr1921_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251