\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0205950133:

Variant ID: vg0205950133 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 5950133
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, A: 0.02, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


GGTTGGTGTTATCAACCGGGACTAAAGAGAGGGGATCTTTAGTCCTGGTTGATAACACCAACCGGGACTAAAAAGAGGGAAGCGACAGTGAGATGGTCCC[C/A]
TTTTCTTTTTTTTTCTTTTTTATTTTCTCCCGAATCGAGTGGGATATATATCTCAAATCAAACCCAAATCCCCAAATCAAAATAACATCCCAAATCTTAA

Reverse complement sequence

TTAAGATTTGGGATGTTATTTTGATTTGGGGATTTGGGTTTGATTTGAGATATATATCCCACTCGATTCGGGAGAAAATAAAAAAGAAAAAAAAAGAAAA[G/T]
GGGACCATCTCACTGTCGCTTCCCTCTTTTTAGTCCCGGTTGGTGTTATCAACCAGGACTAAAGATCCCCTCTCTTTAGTCCCGGTTGATAACACCAACC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.30% 16.60% 6.90% 0.25% NA
All Indica  2759 71.60% 16.70% 11.27% 0.43% NA
All Japonica  1512 98.90% 0.90% 0.13% 0.00% NA
Aus  269 8.90% 90.70% 0.37% 0.00% NA
Indica I  595 86.40% 0.70% 12.61% 0.34% NA
Indica II  465 62.60% 27.10% 10.11% 0.22% NA
Indica III  913 71.60% 18.30% 9.75% 0.33% NA
Indica Intermediate  786 65.80% 20.70% 12.72% 0.76% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 98.40% 1.60% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 1.70% 0.83% 0.00% NA
VI/Aromatic  96 43.80% 52.10% 4.17% 0.00% NA
Intermediate  90 74.40% 16.70% 8.89% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0205950133 C -> A LOC_Os02g11100.1 upstream_gene_variant ; 2186.0bp to feature; MODIFIER silent_mutation Average:38.663; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N
vg0205950133 C -> A LOC_Os02g11090.1 downstream_gene_variant ; 3810.0bp to feature; MODIFIER silent_mutation Average:38.663; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N
vg0205950133 C -> A LOC_Os02g11110.1 downstream_gene_variant ; 4867.0bp to feature; MODIFIER silent_mutation Average:38.663; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N
vg0205950133 C -> A LOC_Os02g11090-LOC_Os02g11100 intergenic_region ; MODIFIER silent_mutation Average:38.663; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N
vg0205950133 C -> DEL N N silent_mutation Average:38.663; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0205950133 NA 4.67E-13 mr1231 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205950133 NA 1.39E-11 mr1232 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205950133 NA 4.71E-07 mr1410 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205950133 NA 1.37E-18 mr1557 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205950133 8.93E-06 8.77E-11 mr1004_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205950133 NA 6.30E-11 mr1166_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205950133 NA 6.30E-12 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205950133 NA 7.59E-19 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205950133 NA 2.12E-09 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205950133 NA 4.45E-07 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205950133 NA 2.37E-07 mr1582_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205950133 NA 3.35E-09 mr1609_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205950133 NA 3.93E-07 mr1735_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205950133 NA 1.42E-08 mr1762_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205950133 NA 4.64E-08 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205950133 NA 3.23E-08 mr1805_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205950133 NA 2.03E-13 mr1846_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205950133 NA 3.24E-08 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251