Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0205946715:

Variant ID: vg0205946715 (JBrowse)	Variation Type: INDEL
Chromosome: chr02	Position: 5946715
Reference Allele: GCT	Alternative Allele: GT,ACT,G
Primary Allele: GT	Secondary Allele: GCT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAAGGTGCCAGTTTTATATGTTTTCAGTCAGTGGATGAGGGAAAAGCACTATAGGTGTCGGTTTTATGTGTTCCGGCACCTATAGTGCCGATCTCTGTGG[GCT/GT,ACT,G]
TTTTTTTATTAGTGTTCACCGGTGAACCGCCAAACCGATGATCGTCTCTGATAGTCTAGGTACCTATTTCTTTTGACACTTCACCGGTGATGCCTGCAAT

Reverse complement sequence

ATTGCAGGCATCACCGGTGAAGTGTCAAAAGAAATAGGTACCTAGACTATCAGAGACGATCATCGGTTTGGCGGTTCACCGGTGAACACTAATAAAAAAA[AGC/AC,AGT,C]
CCACAGAGATCGGCACTATAGGTGCCGGAACACATAAAACCGACACCTATAGTGCTTTTCCCTCATCCACTGACTGAAAACATATAAAACTGGCACCTTT

Allele Frequencies:

Populations	Population Size	Frequency of GT(primary allele)	Frequency of GCT(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	26.00%	22.20%	4.55%	37.39%	ACT: 9.88%; G: 0.04%
All Indica	2759	42.50%	2.40%	3.55%	51.29%	ACT: 0.25%; G: 0.07%
All Japonica	1512	1.20%	63.40%	6.55%	1.46%	ACT: 27.45%
Aus	269	0.00%	2.20%	2.23%	95.54%	NA
Indica I	595	32.40%	1.30%	0.84%	65.38%	NA
Indica II	465	38.10%	1.10%	4.95%	55.27%	ACT: 0.65%
Indica III	913	50.30%	2.40%	2.41%	44.69%	G: 0.22%
Indica Intermediate	786	43.60%	3.80%	6.11%	45.93%	ACT: 0.51%
Temperate Japonica	767	1.30%	87.10%	8.60%	1.17%	ACT: 1.83%
Tropical Japonica	504	0.40%	22.40%	2.38%	1.79%	ACT: 73.02%
Japonica Intermediate	241	2.50%	73.40%	8.71%	1.66%	ACT: 13.69%
VI/Aromatic	96	7.30%	5.20%	1.04%	54.17%	ACT: 32.29%
Intermediate	90	33.30%	15.60%	12.22%	23.33%	ACT: 15.56%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0205946715	GCT -> G	LOC_Os02g11090.1	downstream_gene_variant ; 393.0bp to feature; MODIFIER	silent_mutation	Average:61.597; most accessible tissue: Zhenshan97 panicle, score: 69.946	N	N	N	N
vg0205946715	GCT -> G	LOC_Os02g11090-LOC_Os02g11100	intergenic_region ; MODIFIER	silent_mutation	Average:61.597; most accessible tissue: Zhenshan97 panicle, score: 69.946	N	N	N	N
vg0205946715	GCT -> ACT	LOC_Os02g11090.1	downstream_gene_variant ; 392.0bp to feature; MODIFIER	silent_mutation	Average:61.597; most accessible tissue: Zhenshan97 panicle, score: 69.946	N	N	N	N
vg0205946715	GCT -> ACT	LOC_Os02g11090-LOC_Os02g11100	intergenic_region ; MODIFIER	silent_mutation	Average:61.597; most accessible tissue: Zhenshan97 panicle, score: 69.946	N	N	N	N
vg0205946715	GCT -> GT	LOC_Os02g11090.1	downstream_gene_variant ; 393.0bp to feature; MODIFIER	silent_mutation	Average:61.597; most accessible tissue: Zhenshan97 panicle, score: 69.946	N	N	N	N
vg0205946715	GCT -> GT	LOC_Os02g11090-LOC_Os02g11100	intergenic_region ; MODIFIER	silent_mutation	Average:61.597; most accessible tissue: Zhenshan97 panicle, score: 69.946	N	N	N	N
vg0205946715	GCT -> DEL	N	N	silent_mutation	Average:61.597; most accessible tissue: Zhenshan97 panicle, score: 69.946	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0205946715	NA	1.69E-06	mr1031	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205946715	NA	1.96E-09	mr1097	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205946715	NA	6.10E-08	mr1338	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205946715	NA	3.86E-09	mr1539	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205946715	NA	5.68E-06	mr1543	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205946715	NA	1.97E-07	mr1543	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205946715	NA	5.23E-32	mr1699	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205946715	NA	5.38E-08	mr1851	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205946715	NA	1.33E-12	mr1864	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205946715	NA	8.64E-16	mr1871	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205946715	NA	6.33E-06	mr1871	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205946715	NA	2.26E-10	mr1398_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205946715	NA	4.84E-07	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205946715	NA	7.27E-14	mr1552_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205946715	NA	2.34E-07	mr1682_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205946715	NA	4.47E-09	mr1696_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205946715	NA	4.41E-07	mr1696_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205946715	NA	2.90E-29	mr1699_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205946715	NA	5.56E-09	mr1905_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205946715	8.87E-06	NA	mr1961_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251