\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0205946715:

Variant ID: vg0205946715 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 5946715
Reference Allele: GCTAlternative Allele: GT,ACT,G
Primary Allele: GTSecondary Allele: GCT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAGGTGCCAGTTTTATATGTTTTCAGTCAGTGGATGAGGGAAAAGCACTATAGGTGTCGGTTTTATGTGTTCCGGCACCTATAGTGCCGATCTCTGTGG[GCT/GT,ACT,G]
TTTTTTTATTAGTGTTCACCGGTGAACCGCCAAACCGATGATCGTCTCTGATAGTCTAGGTACCTATTTCTTTTGACACTTCACCGGTGATGCCTGCAAT

Reverse complement sequence

ATTGCAGGCATCACCGGTGAAGTGTCAAAAGAAATAGGTACCTAGACTATCAGAGACGATCATCGGTTTGGCGGTTCACCGGTGAACACTAATAAAAAAA[AGC/AC,AGT,C]
CCACAGAGATCGGCACTATAGGTGCCGGAACACATAAAACCGACACCTATAGTGCTTTTCCCTCATCCACTGACTGAAAACATATAAAACTGGCACCTTT

Allele Frequencies:

Populations Population SizeFrequency of GT(primary allele) Frequency of GCT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 26.00% 22.20% 4.55% 37.39% ACT: 9.88%; G: 0.04%
All Indica  2759 42.50% 2.40% 3.55% 51.29% ACT: 0.25%; G: 0.07%
All Japonica  1512 1.20% 63.40% 6.55% 1.46% ACT: 27.45%
Aus  269 0.00% 2.20% 2.23% 95.54% NA
Indica I  595 32.40% 1.30% 0.84% 65.38% NA
Indica II  465 38.10% 1.10% 4.95% 55.27% ACT: 0.65%
Indica III  913 50.30% 2.40% 2.41% 44.69% G: 0.22%
Indica Intermediate  786 43.60% 3.80% 6.11% 45.93% ACT: 0.51%
Temperate Japonica  767 1.30% 87.10% 8.60% 1.17% ACT: 1.83%
Tropical Japonica  504 0.40% 22.40% 2.38% 1.79% ACT: 73.02%
Japonica Intermediate  241 2.50% 73.40% 8.71% 1.66% ACT: 13.69%
VI/Aromatic  96 7.30% 5.20% 1.04% 54.17% ACT: 32.29%
Intermediate  90 33.30% 15.60% 12.22% 23.33% ACT: 15.56%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0205946715 GCT -> G LOC_Os02g11090.1 downstream_gene_variant ; 393.0bp to feature; MODIFIER silent_mutation Average:61.597; most accessible tissue: Zhenshan97 panicle, score: 69.946 N N N N
vg0205946715 GCT -> G LOC_Os02g11090-LOC_Os02g11100 intergenic_region ; MODIFIER silent_mutation Average:61.597; most accessible tissue: Zhenshan97 panicle, score: 69.946 N N N N
vg0205946715 GCT -> ACT LOC_Os02g11090.1 downstream_gene_variant ; 392.0bp to feature; MODIFIER silent_mutation Average:61.597; most accessible tissue: Zhenshan97 panicle, score: 69.946 N N N N
vg0205946715 GCT -> ACT LOC_Os02g11090-LOC_Os02g11100 intergenic_region ; MODIFIER silent_mutation Average:61.597; most accessible tissue: Zhenshan97 panicle, score: 69.946 N N N N
vg0205946715 GCT -> GT LOC_Os02g11090.1 downstream_gene_variant ; 393.0bp to feature; MODIFIER silent_mutation Average:61.597; most accessible tissue: Zhenshan97 panicle, score: 69.946 N N N N
vg0205946715 GCT -> GT LOC_Os02g11090-LOC_Os02g11100 intergenic_region ; MODIFIER silent_mutation Average:61.597; most accessible tissue: Zhenshan97 panicle, score: 69.946 N N N N
vg0205946715 GCT -> DEL N N silent_mutation Average:61.597; most accessible tissue: Zhenshan97 panicle, score: 69.946 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0205946715 NA 1.69E-06 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205946715 NA 1.96E-09 mr1097 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205946715 NA 6.10E-08 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205946715 NA 3.86E-09 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205946715 NA 5.68E-06 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205946715 NA 1.97E-07 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205946715 NA 5.23E-32 mr1699 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205946715 NA 5.38E-08 mr1851 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205946715 NA 1.33E-12 mr1864 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205946715 NA 8.64E-16 mr1871 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205946715 NA 6.33E-06 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205946715 NA 2.26E-10 mr1398_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205946715 NA 4.84E-07 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205946715 NA 7.27E-14 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205946715 NA 2.34E-07 mr1682_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205946715 NA 4.47E-09 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205946715 NA 4.41E-07 mr1696_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205946715 NA 2.90E-29 mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205946715 NA 5.56E-09 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205946715 8.87E-06 NA mr1961_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251