\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0205856474:

Variant ID: vg0205856474 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 5856474
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.07, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


TAGCTAAGTAAGGCCAAGTACTCATTAATTGTGACCTATTTGGTTTTTAGCGATTCTTCTGAACTCCAAAGGCTGTTCATTAATTGTTCAGATCAGCAAA[T/C]
CCATGAACTATGCAATGATTAGCAGCACGCGAGCGAGCGATCGATCGAGCCTCGAGCTGGCCGTCACACAAATTCTAATAGTACCACAACAATTAATCTA

Reverse complement sequence

TAGATTAATTGTTGTGGTACTATTAGAATTTGTGTGACGGCCAGCTCGAGGCTCGATCGATCGCTCGCTCGCGTGCTGCTAATCATTGCATAGTTCATGG[A/G]
TTTGCTGATCTGAACAATTAATGAACAGCCTTTGGAGTTCAGAAGAATCGCTAAAAACCAAATAGGTCACAATTAATGAGTACTTGGCCTTACTTAGCTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.90% 13.90% 0.19% 0.00% NA
All Indica  2759 88.60% 11.10% 0.33% 0.00% NA
All Japonica  1512 99.10% 0.90% 0.00% 0.00% NA
Aus  269 3.00% 97.00% 0.00% 0.00% NA
Indica I  595 92.10% 7.90% 0.00% 0.00% NA
Indica II  465 96.30% 3.70% 0.00% 0.00% NA
Indica III  913 85.40% 14.60% 0.00% 0.00% NA
Indica Intermediate  786 85.00% 13.90% 1.15% 0.00% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 98.80% 1.20% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 37.50% 62.50% 0.00% 0.00% NA
Intermediate  90 82.20% 17.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0205856474 T -> C LOC_Os02g11010.1 upstream_gene_variant ; 581.0bp to feature; MODIFIER silent_mutation Average:56.009; most accessible tissue: Callus, score: 86.193 N N N N
vg0205856474 T -> C LOC_Os02g11010-LOC_Os02g11020 intergenic_region ; MODIFIER silent_mutation Average:56.009; most accessible tissue: Callus, score: 86.193 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0205856474 NA 2.28E-06 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205856474 NA 5.11E-06 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205856474 NA 1.24E-06 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205856474 NA 1.84E-06 mr1153 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205856474 NA 6.65E-14 mr1166 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205856474 NA 3.26E-13 mr1231 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205856474 NA 1.19E-21 mr1247 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205856474 NA 2.43E-06 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205856474 NA 7.80E-24 mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205856474 NA 5.37E-07 mr1415 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205856474 NA 2.99E-07 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205856474 NA 5.38E-09 mr1465 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205856474 NA 8.03E-20 mr1515 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205856474 NA 8.53E-14 mr1522 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205856474 NA 5.37E-07 mr1567 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205856474 NA 1.99E-06 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205856474 NA 8.66E-07 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205856474 NA 1.84E-07 mr1762 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205856474 NA 4.01E-19 mr1765 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205856474 NA 2.58E-19 mr1911 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205856474 NA 3.35E-08 mr1929 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205856474 NA 1.59E-19 mr1961 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205856474 NA 1.64E-21 mr1095_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205856474 NA 1.06E-24 mr1120_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205856474 NA 2.74E-09 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205856474 NA 1.57E-13 mr1166_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205856474 NA 1.13E-23 mr1247_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205856474 NA 1.40E-21 mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205856474 NA 8.07E-08 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205856474 NA 2.23E-09 mr1762_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205856474 NA 6.63E-09 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205856474 NA 5.79E-07 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205856474 NA 9.63E-09 mr1798_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205856474 NA 1.43E-13 mr1846_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205856474 NA 1.02E-14 mr1961_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251