\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0205823956:

Variant ID: vg0205823956 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 5823956
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.87, T: 0.13, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


CAAGCAGATAGTACGTCCTGCAATCCAAGCATGCAGTACTAGAAGCTCAAAACAAACAGCTACTCCCTCCGTTTCACAATGTAAGTCATTCTAGTATTTT[C/T]
CCCATTTATATTAATGTTAATGGATCGGGTGTGTTTGGTTGCAAGCCACACTTTGCCACAGTTTGCCACGCCTAAGGTTAGTCAAATTTGACAGGTGTTT

Reverse complement sequence

AAACACCTGTCAAATTTGACTAACCTTAGGCGTGGCAAACTGTGGCAAAGTGTGGCTTGCAACCAAACACACCCGATCCATTAACATTAATATAAATGGG[G/A]
AAAATACTAGAATGACTTACATTGTGAAACGGAGGGAGTAGCTGTTTGTTTTGAGCTTCTAGTACTGCATGCTTGGATTGCAGGACGTACTATCTGCTTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.10% 48.80% 0.08% 0.00% NA
All Indica  2759 85.20% 14.70% 0.11% 0.00% NA
All Japonica  1512 1.70% 98.30% 0.00% 0.00% NA
Aus  269 0.40% 99.60% 0.00% 0.00% NA
Indica I  595 98.00% 1.80% 0.17% 0.00% NA
Indica II  465 81.70% 18.10% 0.22% 0.00% NA
Indica III  913 82.10% 17.70% 0.11% 0.00% NA
Indica Intermediate  786 81.20% 18.80% 0.00% 0.00% NA
Temperate Japonica  767 2.20% 97.80% 0.00% 0.00% NA
Tropical Japonica  504 0.80% 99.20% 0.00% 0.00% NA
Japonica Intermediate  241 1.70% 98.30% 0.00% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 38.90% 60.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0205823956 C -> T LOC_Os02g10950.1 upstream_gene_variant ; 4775.0bp to feature; MODIFIER silent_mutation Average:48.065; most accessible tissue: Callus, score: 90.392 N N N N
vg0205823956 C -> T LOC_Os02g10970.1 upstream_gene_variant ; 2339.0bp to feature; MODIFIER silent_mutation Average:48.065; most accessible tissue: Callus, score: 90.392 N N N N
vg0205823956 C -> T LOC_Os02g10970.3 upstream_gene_variant ; 2339.0bp to feature; MODIFIER silent_mutation Average:48.065; most accessible tissue: Callus, score: 90.392 N N N N
vg0205823956 C -> T LOC_Os02g10960.1 downstream_gene_variant ; 572.0bp to feature; MODIFIER silent_mutation Average:48.065; most accessible tissue: Callus, score: 90.392 N N N N
vg0205823956 C -> T LOC_Os02g10950-LOC_Os02g10960 intergenic_region ; MODIFIER silent_mutation Average:48.065; most accessible tissue: Callus, score: 90.392 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0205823956 NA 1.24E-32 mr1161 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205823956 NA 5.96E-13 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205823956 NA 3.99E-29 mr1221 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205823956 NA 2.24E-08 mr1260 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205823956 NA 3.28E-10 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205823956 NA 1.84E-12 mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205823956 NA 7.90E-17 mr1583 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205823956 5.99E-06 NA mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205823956 NA 2.64E-12 mr1769 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205823956 NA 2.60E-15 mr1807 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205823956 NA 6.29E-07 mr1850 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205823956 NA 9.49E-18 mr1870 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205823956 NA 4.01E-06 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205823956 NA 3.02E-16 mr1916 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205823956 NA 5.47E-07 mr1925 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205823956 NA 1.73E-23 mr1943 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205823956 3.99E-06 2.96E-11 mr1951 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205823956 NA 2.93E-07 mr1446_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205823956 NA 3.53E-13 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205823956 NA 6.42E-14 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205823956 NA 4.37E-68 mr1798_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205823956 NA 1.24E-17 mr1870_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205823956 NA 1.78E-24 mr1916_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205823956 NA 2.41E-08 mr1925_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205823956 NA 1.73E-25 mr1943_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205823956 NA 5.88E-10 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251