Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0205823956:

Variant ID: vg0205823956 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 5823956
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.87, T: 0.13, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:

CAAGCAGATAGTACGTCCTGCAATCCAAGCATGCAGTACTAGAAGCTCAAAACAAACAGCTACTCCCTCCGTTTCACAATGTAAGTCATTCTAGTATTTT[C/T]
CCCATTTATATTAATGTTAATGGATCGGGTGTGTTTGGTTGCAAGCCACACTTTGCCACAGTTTGCCACGCCTAAGGTTAGTCAAATTTGACAGGTGTTT

Reverse complement sequence

AAACACCTGTCAAATTTGACTAACCTTAGGCGTGGCAAACTGTGGCAAAGTGTGGCTTGCAACCAAACACACCCGATCCATTAACATTAATATAAATGGG[G/A]
AAAATACTAGAATGACTTACATTGTGAAACGGAGGGAGTAGCTGTTTGTTTTGAGCTTCTAGTACTGCATGCTTGGATTGCAGGACGTACTATCTGCTTG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.10%	48.80%	0.08%	0.00%	NA
All Indica	2759	85.20%	14.70%	0.11%	0.00%	NA
All Japonica	1512	1.70%	98.30%	0.00%	0.00%	NA
Aus	269	0.40%	99.60%	0.00%	0.00%	NA
Indica I	595	98.00%	1.80%	0.17%	0.00%	NA
Indica II	465	81.70%	18.10%	0.22%	0.00%	NA
Indica III	913	82.10%	17.70%	0.11%	0.00%	NA
Indica Intermediate	786	81.20%	18.80%	0.00%	0.00%	NA
Temperate Japonica	767	2.20%	97.80%	0.00%	0.00%	NA
Tropical Japonica	504	0.80%	99.20%	0.00%	0.00%	NA
Japonica Intermediate	241	1.70%	98.30%	0.00%	0.00%	NA
VI/Aromatic	96	4.20%	95.80%	0.00%	0.00%	NA
Intermediate	90	38.90%	60.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0205823956	C -> T	LOC_Os02g10950.1	upstream_gene_variant ; 4775.0bp to feature; MODIFIER	silent_mutation	Average:48.065; most accessible tissue: Callus, score: 90.392	N	N	N	N
vg0205823956	C -> T	LOC_Os02g10970.1	upstream_gene_variant ; 2339.0bp to feature; MODIFIER	silent_mutation	Average:48.065; most accessible tissue: Callus, score: 90.392	N	N	N	N
vg0205823956	C -> T	LOC_Os02g10970.3	upstream_gene_variant ; 2339.0bp to feature; MODIFIER	silent_mutation	Average:48.065; most accessible tissue: Callus, score: 90.392	N	N	N	N
vg0205823956	C -> T	LOC_Os02g10960.1	downstream_gene_variant ; 572.0bp to feature; MODIFIER	silent_mutation	Average:48.065; most accessible tissue: Callus, score: 90.392	N	N	N	N
vg0205823956	C -> T	LOC_Os02g10950-LOC_Os02g10960	intergenic_region ; MODIFIER	silent_mutation	Average:48.065; most accessible tissue: Callus, score: 90.392	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0205823956	NA	1.24E-32	mr1161	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205823956	NA	5.96E-13	mr1183	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205823956	NA	3.99E-29	mr1221	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205823956	NA	2.24E-08	mr1260	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205823956	NA	3.28E-10	mr1352	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205823956	NA	1.84E-12	mr1498	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205823956	NA	7.90E-17	mr1583	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205823956	5.99E-06	NA	mr1769	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205823956	NA	2.64E-12	mr1769	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205823956	NA	2.60E-15	mr1807	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205823956	NA	6.29E-07	mr1850	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205823956	NA	9.49E-18	mr1870	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205823956	NA	4.01E-06	mr1881	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205823956	NA	3.02E-16	mr1916	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205823956	NA	5.47E-07	mr1925	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205823956	NA	1.73E-23	mr1943	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205823956	3.99E-06	2.96E-11	mr1951	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205823956	NA	2.93E-07	mr1446_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205823956	NA	3.53E-13	mr1498_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205823956	NA	6.42E-14	mr1769_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205823956	NA	4.37E-68	mr1798_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205823956	NA	1.24E-17	mr1870_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205823956	NA	1.78E-24	mr1916_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205823956	NA	2.41E-08	mr1925_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205823956	NA	1.73E-25	mr1943_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205823956	NA	5.88E-10	mr1951_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251