\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0205732616:

Variant ID: vg0205732616 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 5732616
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTAAAAATAACACCTAATTATATTATACACTGAAAAAGCGTGCGATCTCCATAATAGGAGTAGCAATCGGTGATGAGACTGTAGGAGAACAAACACTAT[G/A]
TGAAAAAAATAATGGGAAAAGGTAGCCATAGGCTATATGGAGCATGGAAGAATGTGAAGGAGCGCATATAAGTATGTTTGGTTTCGTACAACAAGCTTTA

Reverse complement sequence

TAAAGCTTGTTGTACGAAACCAAACATACTTATATGCGCTCCTTCACATTCTTCCATGCTCCATATAGCCTATGGCTACCTTTTCCCATTATTTTTTTCA[C/T]
ATAGTGTTTGTTCTCCTACAGTCTCATCACCGATTGCTACTCCTATTATGGAGATCGCACGCTTTTTCAGTGTATAATATAATTAGGTGTTATTTTTAAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.20% 43.90% 4.55% 2.37% NA
All Indica  2759 81.80% 15.30% 1.63% 1.27% NA
All Japonica  1512 1.40% 98.20% 0.33% 0.07% NA
Aus  269 0.40% 20.80% 54.65% 24.16% NA
Indica I  595 86.40% 13.40% 0.17% 0.00% NA
Indica II  465 92.90% 6.00% 0.43% 0.65% NA
Indica III  913 79.60% 18.00% 1.10% 1.31% NA
Indica Intermediate  786 74.40% 19.00% 4.07% 2.54% NA
Temperate Japonica  767 1.70% 98.30% 0.00% 0.00% NA
Tropical Japonica  504 0.80% 98.20% 0.79% 0.20% NA
Japonica Intermediate  241 1.70% 97.90% 0.41% 0.00% NA
VI/Aromatic  96 5.20% 70.80% 14.58% 9.38% NA
Intermediate  90 43.30% 50.00% 4.44% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0205732616 G -> A LOC_Os02g10794.1 upstream_gene_variant ; 444.0bp to feature; MODIFIER silent_mutation Average:59.85; most accessible tissue: Zhenshan97 flower, score: 73.414 N N N N
vg0205732616 G -> A LOC_Os02g10800.1 upstream_gene_variant ; 3990.0bp to feature; MODIFIER silent_mutation Average:59.85; most accessible tissue: Zhenshan97 flower, score: 73.414 N N N N
vg0205732616 G -> A LOC_Os02g10800.3 upstream_gene_variant ; 3988.0bp to feature; MODIFIER silent_mutation Average:59.85; most accessible tissue: Zhenshan97 flower, score: 73.414 N N N N
vg0205732616 G -> A LOC_Os02g10800.2 upstream_gene_variant ; 3989.0bp to feature; MODIFIER silent_mutation Average:59.85; most accessible tissue: Zhenshan97 flower, score: 73.414 N N N N
vg0205732616 G -> A LOC_Os02g10794-LOC_Os02g10800 intergenic_region ; MODIFIER silent_mutation Average:59.85; most accessible tissue: Zhenshan97 flower, score: 73.414 N N N N
vg0205732616 G -> DEL N N silent_mutation Average:59.85; most accessible tissue: Zhenshan97 flower, score: 73.414 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0205732616 NA 4.10E-32 mr1037 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205732616 NA 3.80E-06 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205732616 NA 4.60E-40 mr1094 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205732616 NA 1.66E-53 mr1096 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205732616 NA 2.64E-45 mr1111 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205732616 NA 3.96E-42 mr1144 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205732616 NA 2.59E-13 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205732616 NA 8.31E-30 mr1237 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205732616 NA 1.39E-22 mr1244 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205732616 NA 4.53E-09 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205732616 NA 2.51E-09 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205732616 NA 3.90E-50 mr1458 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205732616 NA 4.89E-07 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205732616 NA 1.83E-08 mr1465 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205732616 NA 5.25E-13 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205732616 NA 3.40E-24 mr1551 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205732616 NA 3.33E-10 mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205732616 NA 1.82E-06 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205732616 NA 2.25E-50 mr1798 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205732616 NA 8.84E-26 mr1877 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205732616 NA 2.80E-09 mr1929 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205732616 NA 2.40E-36 mr1037_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205732616 NA 5.20E-07 mr1037_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205732616 NA 7.37E-51 mr1063_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205732616 NA 1.72E-48 mr1091_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205732616 NA 3.89E-48 mr1094_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205732616 NA 5.97E-17 mr1180_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205732616 NA 7.10E-22 mr1183_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205732616 NA 1.44E-25 mr1244_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205732616 NA 2.22E-16 mr1260_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205732616 NA 9.62E-21 mr1457_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205732616 NA 8.96E-57 mr1458_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205732616 NA 2.87E-08 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205732616 NA 5.69E-15 mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205732616 NA 2.97E-71 mr1798_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205732616 NA 8.00E-17 mr1870_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251