\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0205557943:

Variant ID: vg0205557943 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 5557943
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTATGAAAACATATTCAATTATTGATTTAATGAAACTAATTTGATATTATAAATATAACTATATTTGTCTATAAACTTAGTTAAACTAGAAGCAGTTTGA[C/T]
TTTTACCAAAGTCAAAACGTCTTATAACGGAGGGAGTATCATATATTTATCTTATTAGTTTATGTTAAAAATTTTTATAAATATTTACTTTCTCCGTTTC

Reverse complement sequence

GAAACGGAGAAAGTAAATATTTATAAAAATTTTTAACATAAACTAATAAGATAAATATATGATACTCCCTCCGTTATAAGACGTTTTGACTTTGGTAAAA[G/A]
TCAAACTGCTTCTAGTTTAACTAAGTTTATAGACAAATATAGTTATATTTATAATATCAAATTAGTTTCATTAAATCAATAATTGAATATGTTTTCATAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.20% 1.60% 0.15% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 95.00% 4.60% 0.46% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.60% 0.40% 0.00% 0.00% NA
Temperate Japonica  767 99.60% 0.00% 0.39% 0.00% NA
Tropical Japonica  504 86.10% 13.10% 0.79% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0205557943 C -> T LOC_Os02g10560.1 upstream_gene_variant ; 2331.0bp to feature; MODIFIER silent_mutation Average:36.006; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0205557943 C -> T LOC_Os02g10550.1 downstream_gene_variant ; 1764.0bp to feature; MODIFIER silent_mutation Average:36.006; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0205557943 C -> T LOC_Os02g10570.1 downstream_gene_variant ; 3355.0bp to feature; MODIFIER silent_mutation Average:36.006; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0205557943 C -> T LOC_Os02g10550-LOC_Os02g10560 intergenic_region ; MODIFIER silent_mutation Average:36.006; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0205557943 NA 2.02E-06 mr1188 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205557943 NA 1.08E-06 mr1218 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205557943 NA 8.50E-07 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205557943 NA 1.51E-06 mr1422 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205557943 NA 1.20E-08 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205557943 NA 2.20E-07 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205557943 NA 2.06E-06 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205557943 NA 2.30E-08 mr1218_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205557943 NA 5.19E-07 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205557943 NA 4.93E-06 mr1583_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205557943 6.85E-08 1.88E-13 mr1850_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251