| Variant ID: vg0205557943 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 5557943 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTATGAAAACATATTCAATTATTGATTTAATGAAACTAATTTGATATTATAAATATAACTATATTTGTCTATAAACTTAGTTAAACTAGAAGCAGTTTGA[C/T]
TTTTACCAAAGTCAAAACGTCTTATAACGGAGGGAGTATCATATATTTATCTTATTAGTTTATGTTAAAAATTTTTATAAATATTTACTTTCTCCGTTTC
GAAACGGAGAAAGTAAATATTTATAAAAATTTTTAACATAAACTAATAAGATAAATATATGATACTCCCTCCGTTATAAGACGTTTTGACTTTGGTAAAA[G/A]
TCAAACTGCTTCTAGTTTAACTAAGTTTATAGACAAATATAGTTATATTTATAATATCAAATTAGTTTCATTAAATCAATAATTGAATATGTTTTCATAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 98.20% | 1.60% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 95.00% | 4.60% | 0.46% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.00% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 86.10% | 13.10% | 0.79% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0205557943 | C -> T | LOC_Os02g10560.1 | upstream_gene_variant ; 2331.0bp to feature; MODIFIER | silent_mutation | Average:36.006; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| vg0205557943 | C -> T | LOC_Os02g10550.1 | downstream_gene_variant ; 1764.0bp to feature; MODIFIER | silent_mutation | Average:36.006; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| vg0205557943 | C -> T | LOC_Os02g10570.1 | downstream_gene_variant ; 3355.0bp to feature; MODIFIER | silent_mutation | Average:36.006; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| vg0205557943 | C -> T | LOC_Os02g10550-LOC_Os02g10560 | intergenic_region ; MODIFIER | silent_mutation | Average:36.006; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0205557943 | NA | 2.02E-06 | mr1188 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205557943 | NA | 1.08E-06 | mr1218 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205557943 | NA | 8.50E-07 | mr1304 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205557943 | NA | 1.51E-06 | mr1422 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205557943 | NA | 1.20E-08 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205557943 | NA | 2.20E-07 | mr1696 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205557943 | NA | 2.06E-06 | mr1188_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205557943 | NA | 2.30E-08 | mr1218_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205557943 | NA | 5.19E-07 | mr1422_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205557943 | NA | 4.93E-06 | mr1583_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205557943 | 6.85E-08 | 1.88E-13 | mr1850_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |