Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0205557943:

Variant ID: vg0205557943 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 5557943
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTATGAAAACATATTCAATTATTGATTTAATGAAACTAATTTGATATTATAAATATAACTATATTTGTCTATAAACTTAGTTAAACTAGAAGCAGTTTGA[C/T]
TTTTACCAAAGTCAAAACGTCTTATAACGGAGGGAGTATCATATATTTATCTTATTAGTTTATGTTAAAAATTTTTATAAATATTTACTTTCTCCGTTTC

Reverse complement sequence

GAAACGGAGAAAGTAAATATTTATAAAAATTTTTAACATAAACTAATAAGATAAATATATGATACTCCCTCCGTTATAAGACGTTTTGACTTTGGTAAAA[G/A]
TCAAACTGCTTCTAGTTTAACTAAGTTTATAGACAAATATAGTTATATTTATAATATCAAATTAGTTTCATTAAATCAATAATTGAATATGTTTTCATAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	98.20%	1.60%	0.15%	0.00%	NA
All Indica	2759	99.90%	0.10%	0.00%	0.00%	NA
All Japonica	1512	95.00%	4.60%	0.46%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.60%	0.40%	0.00%	0.00%	NA
Temperate Japonica	767	99.60%	0.00%	0.39%	0.00%	NA
Tropical Japonica	504	86.10%	13.10%	0.79%	0.00%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	95.60%	4.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0205557943	C -> T	LOC_Os02g10560.1	upstream_gene_variant ; 2331.0bp to feature; MODIFIER	silent_mutation	Average:36.006; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0205557943	C -> T	LOC_Os02g10550.1	downstream_gene_variant ; 1764.0bp to feature; MODIFIER	silent_mutation	Average:36.006; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0205557943	C -> T	LOC_Os02g10570.1	downstream_gene_variant ; 3355.0bp to feature; MODIFIER	silent_mutation	Average:36.006; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0205557943	C -> T	LOC_Os02g10550-LOC_Os02g10560	intergenic_region ; MODIFIER	silent_mutation	Average:36.006; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0205557943	NA	2.02E-06	mr1188	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205557943	NA	1.08E-06	mr1218	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205557943	NA	8.50E-07	mr1304	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205557943	NA	1.51E-06	mr1422	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205557943	NA	1.20E-08	mr1583	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205557943	NA	2.20E-07	mr1696	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205557943	NA	2.06E-06	mr1188_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205557943	NA	2.30E-08	mr1218_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205557943	NA	5.19E-07	mr1422_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205557943	NA	4.93E-06	mr1583_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205557943	6.85E-08	1.88E-13	mr1850_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251