\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0205319579:

Variant ID: vg0205319579 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 5319579
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.06, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


AAATATATTCAATTATTGATTTAATGAAACTAAATTGATATTATATATATTACTATATTTATGCATAAACTTAGTTAAATTTGAAGTAGTTTGACTTTGA[C/T]
CAAAATCAAAACGTCTTACAACCAGATCTGTTTAATATACTAGAGCGACAGAAGTAGCAGTATATTAGCTAGCTAGTATACTAGGTTAATATACTGCATC

Reverse complement sequence

GATGCAGTATATTAACCTAGTATACTAGCTAGCTAATATACTGCTACTTCTGTCGCTCTAGTATATTAAACAGATCTGGTTGTAAGACGTTTTGATTTTG[G/A]
TCAAAGTCAAACTACTTCAAATTTAACTAAGTTTATGCATAAATATAGTAATATATATAATATCAATTTAGTTTCATTAAATCAATAATTGAATATATTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.60% 43.30% 0.08% 0.00% NA
All Indica  2759 81.70% 18.20% 0.14% 0.00% NA
All Japonica  1512 1.80% 98.20% 0.00% 0.00% NA
Aus  269 96.70% 3.30% 0.00% 0.00% NA
Indica I  595 91.30% 8.70% 0.00% 0.00% NA
Indica II  465 84.30% 15.70% 0.00% 0.00% NA
Indica III  913 74.20% 25.80% 0.00% 0.00% NA
Indica Intermediate  786 81.70% 17.80% 0.51% 0.00% NA
Temperate Japonica  767 1.80% 98.20% 0.00% 0.00% NA
Tropical Japonica  504 0.80% 99.20% 0.00% 0.00% NA
Japonica Intermediate  241 3.70% 96.30% 0.00% 0.00% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 53.30% 46.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0205319579 C -> T LOC_Os02g10150.1 upstream_gene_variant ; 2203.0bp to feature; MODIFIER silent_mutation Average:37.215; most accessible tissue: Minghui63 root, score: 85.467 N N N N
vg0205319579 C -> T LOC_Os02g10140.1 downstream_gene_variant ; 1558.0bp to feature; MODIFIER silent_mutation Average:37.215; most accessible tissue: Minghui63 root, score: 85.467 N N N N
vg0205319579 C -> T LOC_Os02g10160.1 downstream_gene_variant ; 4953.0bp to feature; MODIFIER silent_mutation Average:37.215; most accessible tissue: Minghui63 root, score: 85.467 N N N N
vg0205319579 C -> T LOC_Os02g10140-LOC_Os02g10150 intergenic_region ; MODIFIER silent_mutation Average:37.215; most accessible tissue: Minghui63 root, score: 85.467 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0205319579 NA 2.95E-07 mr1003 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205319579 NA 7.75E-07 mr1006 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205319579 NA 2.61E-06 mr1007 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205319579 2.19E-06 2.17E-09 mr1051 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205319579 NA 8.68E-07 mr1052 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205319579 NA 1.41E-06 mr1536 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205319579 NA 1.09E-10 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205319579 NA 2.91E-15 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205319579 NA 2.49E-11 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205319579 NA 1.05E-06 mr1006_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205319579 NA 5.34E-09 mr1051_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205319579 NA 1.26E-06 mr1536_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205319579 NA 3.26E-10 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251