\
| Variant ID: vg0205319579 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 5319579 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.06, others allele: 0.00, population size: 111. )
AAATATATTCAATTATTGATTTAATGAAACTAAATTGATATTATATATATTACTATATTTATGCATAAACTTAGTTAAATTTGAAGTAGTTTGACTTTGA[C/T]
CAAAATCAAAACGTCTTACAACCAGATCTGTTTAATATACTAGAGCGACAGAAGTAGCAGTATATTAGCTAGCTAGTATACTAGGTTAATATACTGCATC
GATGCAGTATATTAACCTAGTATACTAGCTAGCTAATATACTGCTACTTCTGTCGCTCTAGTATATTAAACAGATCTGGTTGTAAGACGTTTTGATTTTG[G/A]
TCAAAGTCAAACTACTTCAAATTTAACTAAGTTTATGCATAAATATAGTAATATATATAATATCAATTTAGTTTCATTAAATCAATAATTGAATATATTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.60% | 43.30% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 81.70% | 18.20% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 1.80% | 98.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 91.30% | 8.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 84.30% | 15.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 74.20% | 25.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 81.70% | 17.80% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 1.80% | 98.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 3.70% | 96.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 90.60% | 9.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 53.30% | 46.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0205319579 | C -> T | LOC_Os02g10150.1 | upstream_gene_variant ; 2203.0bp to feature; MODIFIER | silent_mutation | Average:37.215; most accessible tissue: Minghui63 root, score: 85.467 | N | N | N | N |
| vg0205319579 | C -> T | LOC_Os02g10140.1 | downstream_gene_variant ; 1558.0bp to feature; MODIFIER | silent_mutation | Average:37.215; most accessible tissue: Minghui63 root, score: 85.467 | N | N | N | N |
| vg0205319579 | C -> T | LOC_Os02g10160.1 | downstream_gene_variant ; 4953.0bp to feature; MODIFIER | silent_mutation | Average:37.215; most accessible tissue: Minghui63 root, score: 85.467 | N | N | N | N |
| vg0205319579 | C -> T | LOC_Os02g10140-LOC_Os02g10150 | intergenic_region ; MODIFIER | silent_mutation | Average:37.215; most accessible tissue: Minghui63 root, score: 85.467 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0205319579 | NA | 2.95E-07 | mr1003 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205319579 | NA | 7.75E-07 | mr1006 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205319579 | NA | 2.61E-06 | mr1007 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205319579 | 2.19E-06 | 2.17E-09 | mr1051 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205319579 | NA | 8.68E-07 | mr1052 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205319579 | NA | 1.41E-06 | mr1536 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205319579 | NA | 1.09E-10 | mr1683 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205319579 | NA | 2.91E-15 | mr1909 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205319579 | NA | 2.49E-11 | mr1921 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205319579 | NA | 1.05E-06 | mr1006_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205319579 | NA | 5.34E-09 | mr1051_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205319579 | NA | 1.26E-06 | mr1536_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205319579 | NA | 3.26E-10 | mr1705_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |