\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0205266925:

Variant ID: vg0205266925 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 5266925
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTAATATGTTGCTAAATTTGCAGGGCATTATAACTGGAGGGAGCTTACTTTCCTTACTTACCTCCATTGGGTGGAGCATGTCGACCCGATACAATCATAA[G/A]
AATAAGAGGTAATTGTGTTCTTGTCCCTATTTACAACTGCAATTGTGATTTTACCCTTGTATTTTTAACTTTGTGATTTTACCCTCACTATTTTGAACTG

Reverse complement sequence

CAGTTCAAAATAGTGAGGGTAAAATCACAAAGTTAAAAATACAAGGGTAAAATCACAATTGCAGTTGTAAATAGGGACAAGAACACAATTACCTCTTATT[C/T]
TTATGATTGTATCGGGTCGACATGCTCCACCCAATGGAGGTAAGTAAGGAAAGTAAGCTCCCTCCAGTTATAATGCCCTGCAAATTTAGCAACATATTAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.40% 23.10% 17.96% 7.58% NA
All Indica  2759 33.90% 27.20% 27.84% 11.13% NA
All Japonica  1512 95.20% 1.00% 1.06% 2.78% NA
Aus  269 2.60% 80.70% 16.73% 0.00% NA
Indica I  595 63.50% 0.30% 30.76% 5.38% NA
Indica II  465 15.10% 45.40% 21.51% 18.06% NA
Indica III  913 24.50% 34.70% 28.26% 12.49% NA
Indica Intermediate  786 33.30% 28.00% 28.88% 9.80% NA
Temperate Japonica  767 95.60% 0.50% 1.69% 2.22% NA
Tropical Japonica  504 94.40% 0.60% 0.60% 4.37% NA
Japonica Intermediate  241 95.40% 3.30% 0.00% 1.24% NA
VI/Aromatic  96 11.50% 86.50% 2.08% 0.00% NA
Intermediate  90 42.20% 27.80% 20.00% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0205266925 G -> A LOC_Os02g10100.1 upstream_gene_variant ; 413.0bp to feature; MODIFIER silent_mutation Average:59.304; most accessible tissue: Callus, score: 83.589 N N N N
vg0205266925 G -> A LOC_Os02g10110.1 upstream_gene_variant ; 3311.0bp to feature; MODIFIER silent_mutation Average:59.304; most accessible tissue: Callus, score: 83.589 N N N N
vg0205266925 G -> A LOC_Os02g10100-LOC_Os02g10110 intergenic_region ; MODIFIER silent_mutation Average:59.304; most accessible tissue: Callus, score: 83.589 N N N N
vg0205266925 G -> DEL N N silent_mutation Average:59.304; most accessible tissue: Callus, score: 83.589 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0205266925 NA 2.42E-06 mr1004 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205266925 NA 2.30E-07 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205266925 NA 5.76E-08 mr1007 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205266925 NA 2.21E-07 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205266925 NA 1.28E-06 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205266925 NA 4.25E-11 mr1232 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205266925 NA 5.45E-06 mr1319 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205266925 NA 9.94E-07 mr1415 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205266925 NA 4.86E-07 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205266925 NA 9.94E-07 mr1567 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205266925 NA 3.32E-06 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205266925 NA 1.61E-17 mr1855 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205266925 NA 1.02E-06 mr1036_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205266925 5.00E-06 1.40E-09 mr1036_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205266925 NA 2.44E-07 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205266925 NA 8.17E-10 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205266925 NA 2.10E-07 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205266925 NA 3.14E-06 mr1169_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205266925 NA 1.60E-06 mr1169_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205266925 NA 4.20E-10 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205266925 NA 3.22E-06 mr1398_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205266925 NA 3.23E-08 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205266925 NA 3.03E-16 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205266925 NA 2.46E-08 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205266925 NA 2.81E-06 mr1592_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205266925 NA 1.29E-10 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205266925 NA 3.47E-11 mr1619_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205266925 NA 4.83E-16 mr1715_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205266925 NA 3.29E-06 mr1735_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205266925 NA 2.61E-06 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205266925 NA 1.43E-13 mr1829_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205266925 NA 9.26E-10 mr1842_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205266925 NA 7.95E-06 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205266925 NA 4.46E-12 mr1902_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205266925 NA 2.10E-06 mr1933_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205266925 NA 1.47E-08 mr1962_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251