\
| Variant ID: vg0205107721 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 5107721 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTTAAAAGAGACCACTATAAAAGTTGTTATGAACTAAGGCCTGTTTGTTTCAACTTAAGATTATTGAGCCAGATTATTATAAGCTGGATTATAATAAGTC[G/A]
GCATAGAATAAATTGTTAGCTGTTTGTTTCTCTAGATTATTAGATGCTTGTTAGCTGTTAGCAACCCAATAATCTAAAAAAGCACCTTTAGAGTGGATTA
TAATCCACTCTAAAGGTGCTTTTTTAGATTATTGGGTTGCTAACAGCTAACAAGCATCTAATAATCTAGAGAAACAAACAGCTAACAATTTATTCTATGC[C/T]
GACTTATTATAATCCAGCTTATAATAATCTGGCTCAATAATCTTAAGTTGAAACAAACAGGCCTTAGTTCATAACAACTTTTATAGTGGTCTCTTTTAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.10% | 8.80% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 93.90% | 6.10% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 28.60% | 71.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.10% | 3.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 91.90% | 8.00% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 62.50% | 37.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 15.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0205107721 | G -> A | LOC_Os02g09880.1 | upstream_gene_variant ; 4994.0bp to feature; MODIFIER | silent_mutation | Average:43.558; most accessible tissue: Zhenshan97 panicle, score: 72.468 | N | N | N | N |
| vg0205107721 | G -> A | LOC_Os02g09870-LOC_Os02g09880 | intergenic_region ; MODIFIER | silent_mutation | Average:43.558; most accessible tissue: Zhenshan97 panicle, score: 72.468 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0205107721 | NA | 2.52E-06 | mr1073 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205107721 | NA | 2.58E-09 | mr1207 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205107721 | NA | 4.48E-06 | mr1262 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205107721 | NA | 2.89E-06 | mr1774 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205107721 | NA | 4.79E-06 | mr1931 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |