\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0205036609:

Variant ID: vg0205036609 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 5036609
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATAACTAATAAATATACTAATTCTAATATACTACTAGTCCTAATATTTATTTGGTCAATCTACTCTTTCTCTCTCCTTTTATCTTGAATTTTGTGTAAGG[G/A]
TTATCTCTCTTATTTTACCTCTCTATTTAAGCTTATGTGGTATCTTGAATGTTTATAATAATTGCCATTATGTACATATCACGTAGTACTATGTGGTGTT

Reverse complement sequence

AACACCACATAGTACTACGTGATATGTACATAATGGCAATTATTATAAACATTCAAGATACCACATAAGCTTAAATAGAGAGGTAAAATAAGAGAGATAA[C/T]
CCTTACACAAAATTCAAGATAAAAGGAGAGAGAAAGAGTAGATTGACCAAATAAATATTAGGACTAGTAGTATATTAGAATTAGTATATTTATTAGTTAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.80% 15.20% 0.02% 0.00% NA
All Indica  2759 84.30% 15.70% 0.00% 0.00% NA
All Japonica  1512 99.40% 0.60% 0.00% 0.00% NA
Aus  269 31.20% 68.80% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 85.20% 14.80% 0.00% 0.00% NA
Indica III  913 76.30% 23.70% 0.00% 0.00% NA
Indica Intermediate  786 81.40% 18.60% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 97.10% 2.90% 0.00% 0.00% NA
VI/Aromatic  96 18.80% 80.20% 1.04% 0.00% NA
Intermediate  90 83.30% 16.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0205036609 G -> A LOC_Os02g09760.1 upstream_gene_variant ; 2298.0bp to feature; MODIFIER silent_mutation Average:67.942; most accessible tissue: Minghui63 flower, score: 79.848 N N N N
vg0205036609 G -> A LOC_Os02g09770.1 downstream_gene_variant ; 2295.0bp to feature; MODIFIER silent_mutation Average:67.942; most accessible tissue: Minghui63 flower, score: 79.848 N N N N
vg0205036609 G -> A LOC_Os02g09770.4 downstream_gene_variant ; 1850.0bp to feature; MODIFIER silent_mutation Average:67.942; most accessible tissue: Minghui63 flower, score: 79.848 N N N N
vg0205036609 G -> A LOC_Os02g09770.3 downstream_gene_variant ; 1852.0bp to feature; MODIFIER silent_mutation Average:67.942; most accessible tissue: Minghui63 flower, score: 79.848 N N N N
vg0205036609 G -> A LOC_Os02g09770.2 downstream_gene_variant ; 2295.0bp to feature; MODIFIER silent_mutation Average:67.942; most accessible tissue: Minghui63 flower, score: 79.848 N N N N
vg0205036609 G -> A LOC_Os02g09760-LOC_Os02g09770 intergenic_region ; MODIFIER silent_mutation Average:67.942; most accessible tissue: Minghui63 flower, score: 79.848 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0205036609 NA 3.26E-06 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205036609 NA 9.83E-07 mr1007 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205036609 NA 3.35E-06 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205036609 NA 6.75E-08 mr1004_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205036609 NA 6.45E-07 mr1006_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205036609 NA 6.24E-06 mr1036_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205036609 NA 4.79E-06 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205036609 NA 4.44E-11 mr1166_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205036609 NA 3.03E-06 mr1169_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205036609 NA 5.35E-10 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205036609 NA 3.64E-08 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205036609 NA 7.96E-06 mr1609_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205036609 NA 3.73E-07 mr1619_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205036609 NA 7.66E-06 mr1705_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205036609 NA 9.56E-07 mr1762_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205036609 NA 1.28E-07 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205036609 NA 8.18E-06 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205036609 NA 9.56E-06 mr1813_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205036609 NA 2.17E-10 mr1829_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205036609 NA 2.23E-08 mr1842_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205036609 5.05E-07 3.85E-11 mr1902_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205036609 NA 6.18E-08 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251