Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0205036609:

Variant ID: vg0205036609 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 5036609
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATAACTAATAAATATACTAATTCTAATATACTACTAGTCCTAATATTTATTTGGTCAATCTACTCTTTCTCTCTCCTTTTATCTTGAATTTTGTGTAAGG[G/A]
TTATCTCTCTTATTTTACCTCTCTATTTAAGCTTATGTGGTATCTTGAATGTTTATAATAATTGCCATTATGTACATATCACGTAGTACTATGTGGTGTT

Reverse complement sequence

AACACCACATAGTACTACGTGATATGTACATAATGGCAATTATTATAAACATTCAAGATACCACATAAGCTTAAATAGAGAGGTAAAATAAGAGAGATAA[C/T]
CCTTACACAAAATTCAAGATAAAAGGAGAGAGAAAGAGTAGATTGACCAAATAAATATTAGGACTAGTAGTATATTAGAATTAGTATATTTATTAGTTAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.80%	15.20%	0.02%	0.00%	NA
All Indica	2759	84.30%	15.70%	0.00%	0.00%	NA
All Japonica	1512	99.40%	0.60%	0.00%	0.00%	NA
Aus	269	31.20%	68.80%	0.00%	0.00%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	85.20%	14.80%	0.00%	0.00%	NA
Indica III	913	76.30%	23.70%	0.00%	0.00%	NA
Indica Intermediate	786	81.40%	18.60%	0.00%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	97.10%	2.90%	0.00%	0.00%	NA
VI/Aromatic	96	18.80%	80.20%	1.04%	0.00%	NA
Intermediate	90	83.30%	16.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0205036609	G -> A	LOC_Os02g09760.1	upstream_gene_variant ; 2298.0bp to feature; MODIFIER	silent_mutation	Average:67.942; most accessible tissue: Minghui63 flower, score: 79.848	N	N	N	N
vg0205036609	G -> A	LOC_Os02g09770.1	downstream_gene_variant ; 2295.0bp to feature; MODIFIER	silent_mutation	Average:67.942; most accessible tissue: Minghui63 flower, score: 79.848	N	N	N	N
vg0205036609	G -> A	LOC_Os02g09770.4	downstream_gene_variant ; 1850.0bp to feature; MODIFIER	silent_mutation	Average:67.942; most accessible tissue: Minghui63 flower, score: 79.848	N	N	N	N
vg0205036609	G -> A	LOC_Os02g09770.3	downstream_gene_variant ; 1852.0bp to feature; MODIFIER	silent_mutation	Average:67.942; most accessible tissue: Minghui63 flower, score: 79.848	N	N	N	N
vg0205036609	G -> A	LOC_Os02g09770.2	downstream_gene_variant ; 2295.0bp to feature; MODIFIER	silent_mutation	Average:67.942; most accessible tissue: Minghui63 flower, score: 79.848	N	N	N	N
vg0205036609	G -> A	LOC_Os02g09760-LOC_Os02g09770	intergenic_region ; MODIFIER	silent_mutation	Average:67.942; most accessible tissue: Minghui63 flower, score: 79.848	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0205036609	NA	3.26E-06	mr1006	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205036609	NA	9.83E-07	mr1007	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205036609	NA	3.35E-06	mr1052	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205036609	NA	6.75E-08	mr1004_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205036609	NA	6.45E-07	mr1006_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205036609	NA	6.24E-06	mr1036_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205036609	NA	4.79E-06	mr1120_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205036609	NA	4.44E-11	mr1166_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205036609	NA	3.03E-06	mr1169_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205036609	NA	5.35E-10	mr1232_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205036609	NA	3.64E-08	mr1567_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205036609	NA	7.96E-06	mr1609_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205036609	NA	3.73E-07	mr1619_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205036609	NA	7.66E-06	mr1705_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205036609	NA	9.56E-07	mr1762_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205036609	NA	1.28E-07	mr1765_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205036609	NA	8.18E-06	mr1795_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205036609	NA	9.56E-06	mr1813_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205036609	NA	2.17E-10	mr1829_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205036609	NA	2.23E-08	mr1842_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205036609	5.05E-07	3.85E-11	mr1902_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205036609	NA	6.18E-08	mr1921_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251