\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0205011592:

Variant ID: vg0205011592 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 5011592
Reference Allele: TAlternative Allele: C,G
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTAGATCTATTATTTAAGAAAGTAATCCCTTCCTCTGCTGTGAGCCAGAAAAAGAAAAAAAAACGTACGTACGTACGTAAGTGTGGCTTCGTATAACCG[T/C,G]
GGGCCGGAAAAAGAAAAAAAACATAAGAACGTAGTACGCTCTCCTGTCTCTTCCTCTTCCTATTCTTTTATATCTCCATCTTTTTCTCTTCGTAATTCTT

Reverse complement sequence

AAGAATTACGAAGAGAAAAAGATGGAGATATAAAAGAATAGGAAGAGGAAGAGACAGGAGAGCGTACTACGTTCTTATGTTTTTTTTCTTTTTCCGGCCC[A/G,C]
CGGTTATACGAAGCCACACTTACGTACGTACGTACGTTTTTTTTTCTTTTTCTGGCTCACAGCAGAGGAAGGGATTACTTTCTTAAATAATAGATCTAAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.40% 13.80% 1.27% 2.50% NA
All Indica  2759 81.30% 13.60% 1.63% 3.44% NA
All Japonica  1512 99.30% 0.60% 0.07% 0.00% NA
Aus  269 23.40% 68.00% 3.35% 5.20% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 69.00% 19.60% 4.09% 7.31% NA
Indica III  913 74.00% 20.60% 1.20% 4.16% NA
Indica Intermediate  786 83.00% 12.20% 1.91% 2.93% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 2.50% 0.00% 0.00% NA
VI/Aromatic  96 24.00% 68.80% 2.08% 5.21% NA
Intermediate  90 72.20% 20.00% 3.33% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0205011592 T -> G LOC_Os02g09730.1 upstream_gene_variant ; 3245.0bp to feature; MODIFIER N Average:55.828; most accessible tissue: Zhenshan97 root, score: 77.417 N N N N
vg0205011592 T -> G LOC_Os02g09720-LOC_Os02g09730 intergenic_region ; MODIFIER N Average:55.828; most accessible tissue: Zhenshan97 root, score: 77.417 N N N N
vg0205011592 T -> DEL N N silent_mutation Average:55.828; most accessible tissue: Zhenshan97 root, score: 77.417 N N N N
vg0205011592 T -> C LOC_Os02g09730.1 upstream_gene_variant ; 3245.0bp to feature; MODIFIER silent_mutation Average:55.828; most accessible tissue: Zhenshan97 root, score: 77.417 N N N N
vg0205011592 T -> C LOC_Os02g09720-LOC_Os02g09730 intergenic_region ; MODIFIER silent_mutation Average:55.828; most accessible tissue: Zhenshan97 root, score: 77.417 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0205011592 NA 5.05E-08 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205011592 NA 7.42E-07 mr1808 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205011592 3.11E-06 NA mr1889 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205011592 NA 1.09E-07 mr1612_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251