\
| Variant ID: vg0204732555 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 4732555 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.74, T: 0.26, others allele: 0.00, population size: 53. )
AAATAGGGAGTTCTCAAGCATCAAGAAACCGGCGTGCCATATTAGCTACAGTTTCTGTATAAAAACGCATGAATACTTTGTTGAGGTAAAACGTAAAAGT[C/T]
GTTTTTAAGTAAGCATGTTTCACAAAATGGTGCACTAAGCACTAGTCTGAGTTTTGAACTGCTATTTGGTGGTGGCTACTTTCTCCTGCTCCGTTAGTAT
ATACTAACGGAGCAGGAGAAAGTAGCCACCACCAAATAGCAGTTCAAAACTCAGACTAGTGCTTAGTGCACCATTTTGTGAAACATGCTTACTTAAAAAC[G/A]
ACTTTTACGTTTTACCTCAACAAAGTATTCATGCGTTTTTATACAGAAACTGTAGCTAATATGGCACGCCGGTTTCTTGATGCTTGAGAACTCCCTATTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.90% | 46.80% | 0.23% | 0.00% | NA |
| All Indica | 2759 | 55.90% | 43.70% | 0.40% | 0.00% | NA |
| All Japonica | 1512 | 59.90% | 40.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 2.60% | 97.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 46.60% | 53.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 44.30% | 55.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 66.80% | 32.10% | 1.10% | 0.00% | NA |
| Indica Intermediate | 786 | 57.30% | 42.60% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 93.90% | 6.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 17.10% | 82.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 41.10% | 58.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 4.20% | 95.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 46.70% | 53.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0204732555 | C -> T | LOC_Os02g09210.1 | downstream_gene_variant ; 2235.0bp to feature; MODIFIER | silent_mutation | Average:53.421; most accessible tissue: Callus, score: 83.567 | N | N | N | N |
| vg0204732555 | C -> T | LOC_Os02g09210-LOC_Os02g09220 | intergenic_region ; MODIFIER | silent_mutation | Average:53.421; most accessible tissue: Callus, score: 83.567 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0204732555 | NA | 3.54E-07 | mr1271 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0204732555 | NA | 1.39E-09 | mr1295 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0204732555 | NA | 6.90E-06 | mr1808 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0204732555 | NA | 6.81E-07 | mr1870 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0204732555 | NA | 3.99E-08 | mr1031_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0204732555 | NA | 1.13E-07 | mr1125_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0204732555 | NA | 6.58E-14 | mr1241_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0204732555 | NA | 3.08E-06 | mr1246_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0204732555 | NA | 8.90E-06 | mr1295_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0204732555 | NA | 4.22E-06 | mr1404_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0204732555 | NA | 5.61E-08 | mr1526_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0204732555 | NA | 6.41E-09 | mr1584_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0204732555 | NA | 7.58E-07 | mr1798_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0204732555 | NA | 4.42E-09 | mr1808_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0204732555 | NA | 7.00E-08 | mr1808_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |