\
| Variant ID: vg0204430393 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 4430393 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 259. )
TCATCAGAATCTACTTTTAGTGCTGGGGGAAGAGTTCTAAGTGATTATCGTAGTTCTCTATGCCCAACAATGGTTGAGGCGTTGATATGTGCTTCTAGCT[G/A]
GATTAGAGGCGCTCCAATGATTACGGTACTCACTATTATGCCATGCATATTTAATGCATATTCTCTTCTTAACACATGACATGAGTAGCTGAATTAACTT
AAGTTAATTCAGCTACTCATGTCATGTGTTAAGAAGAGAATATGCATTAAATATGCATGGCATAATAGTGAGTACCGTAATCATTGGAGCGCCTCTAATC[C/T]
AGCTAGAAGCACATATCAACGCCTCAACCATTGTTGGGCATAGAGAACTACGATAATCACTTAGAACTCTTCCCCCAGCACTAAAAGTAGATTCTGATGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.90% | 8.90% | 5.06% | 31.15% | NA |
| All Indica | 2759 | 42.70% | 14.80% | 7.32% | 35.23% | NA |
| All Japonica | 1512 | 71.60% | 0.40% | 1.46% | 26.59% | NA |
| Aus | 269 | 78.40% | 0.00% | 2.60% | 18.96% | NA |
| Indica I | 595 | 48.60% | 23.50% | 15.46% | 12.44% | NA |
| Indica II | 465 | 21.70% | 15.90% | 7.96% | 54.41% | NA |
| Indica III | 913 | 43.30% | 14.90% | 1.86% | 39.98% | NA |
| Indica Intermediate | 786 | 50.00% | 7.30% | 7.12% | 35.62% | NA |
| Temperate Japonica | 767 | 98.00% | 0.00% | 0.00% | 1.96% | NA |
| Tropical Japonica | 504 | 35.30% | 0.40% | 3.37% | 60.91% | NA |
| Japonica Intermediate | 241 | 63.10% | 1.70% | 2.07% | 33.20% | NA |
| VI/Aromatic | 96 | 64.60% | 0.00% | 3.12% | 32.29% | NA |
| Intermediate | 90 | 67.80% | 8.90% | 5.56% | 17.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0204430393 | G -> A | LOC_Os02g08340.1 | stop_gained ; p.Trp677*; HIGH | stop_gained | Average:14.184; most accessible tissue: Callus, score: 42.767 | N | N | N | N |
| vg0204430393 | G -> DEL | LOC_Os02g08340.1 | N | frameshift_variant | Average:14.184; most accessible tissue: Callus, score: 42.767 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0204430393 | 8.43E-09 | 5.66E-12 | mr1191 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0204430393 | 4.82E-13 | 3.71E-17 | mr1191 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0204430393 | 1.23E-10 | 3.34E-14 | mr1644 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0204430393 | 1.31E-14 | 9.73E-19 | mr1644 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0204430393 | NA | 6.74E-07 | mr1662 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0204430393 | 4.16E-10 | 2.47E-17 | mr1191_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0204430393 | 7.72E-11 | 2.64E-22 | mr1191_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0204430393 | NA | 7.97E-06 | mr1380_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0204430393 | NA | 1.40E-06 | mr1662_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0204430393 | NA | 3.11E-07 | mr1662_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0204430393 | NA | 8.77E-07 | mr1745_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0204430393 | NA | 5.93E-06 | mr1908_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |