Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0204076184:

Variant ID: vg0204076184 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 4076184
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.95, A: 0.05, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:

CAGTGTGCTGCTAAGCTTATGTCACTATAGTTGACGAAGTGTTTCAAACATAAAAGACAACAGAGTTTTTAGTAAGATTCTAATTGGAAAAGAAAAAAAA[T/A]
ACCGTGTTTTGTGTGATAGTAAACATCCTACAGTTTCAACTATATAAGTAGTTCTCTTGTGGTCATTGGGCAGAGAATTACTTCTCCAGTTAGCAATACA

Reverse complement sequence

TGTATTGCTAACTGGAGAAGTAATTCTCTGCCCAATGACCACAAGAGAACTACTTATATAGTTGAAACTGTAGGATGTTTACTATCACACAAAACACGGT[A/T]
TTTTTTTTCTTTTCCAATTAGAATCTTACTAAAAACTCTGTTGTCTTTTATGTTTGAAACACTTCGTCAACTATAGTGACATAAGCTTAGCAGCACACTG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.70%	21.10%	0.11%	0.11%	NA
All Indica	2759	69.20%	30.50%	0.14%	0.18%	NA
All Japonica	1512	98.70%	1.30%	0.00%	0.00%	NA
Aus	269	52.00%	47.60%	0.37%	0.00%	NA
Indica I	595	67.40%	32.10%	0.34%	0.17%	NA
Indica II	465	76.80%	22.40%	0.22%	0.65%	NA
Indica III	913	66.00%	34.00%	0.00%	0.00%	NA
Indica Intermediate	786	69.60%	30.20%	0.13%	0.13%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	96.60%	3.40%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	91.10%	8.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0204076184	T -> A	LOC_Os02g07780.2	3_prime_UTR_variant ; 311.0bp to feature; MODIFIER	silent_mutation	Average:49.755; most accessible tissue: Callus, score: 72.367	N	N	N	N
vg0204076184	T -> A	LOC_Os02g07790.1	downstream_gene_variant ; 2195.0bp to feature; MODIFIER	silent_mutation	Average:49.755; most accessible tissue: Callus, score: 72.367	N	N	N	N
vg0204076184	T -> A	LOC_Os02g07780.1	intron_variant ; MODIFIER	silent_mutation	Average:49.755; most accessible tissue: Callus, score: 72.367	N	N	N	N
vg0204076184	T -> DEL	N	N	silent_mutation	Average:49.755; most accessible tissue: Callus, score: 72.367	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0204076184	NA	5.75E-09	mr1141	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204076184	NA	5.15E-06	mr1192	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204076184	NA	1.61E-07	mr1739	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204076184	NA	1.96E-07	mr1739	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204076184	NA	8.27E-07	mr1358_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204076184	NA	7.62E-06	mr1358_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204076184	NA	6.66E-07	mr1378_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204076184	NA	7.60E-08	mr1566_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204076184	NA	8.00E-06	mr1566_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204076184	NA	6.76E-08	mr1654_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204076184	NA	6.32E-11	mr1739_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204076184	NA	8.81E-10	mr1739_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251