\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0204076184:

Variant ID: vg0204076184 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 4076184
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.95, A: 0.05, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


CAGTGTGCTGCTAAGCTTATGTCACTATAGTTGACGAAGTGTTTCAAACATAAAAGACAACAGAGTTTTTAGTAAGATTCTAATTGGAAAAGAAAAAAAA[T/A]
ACCGTGTTTTGTGTGATAGTAAACATCCTACAGTTTCAACTATATAAGTAGTTCTCTTGTGGTCATTGGGCAGAGAATTACTTCTCCAGTTAGCAATACA

Reverse complement sequence

TGTATTGCTAACTGGAGAAGTAATTCTCTGCCCAATGACCACAAGAGAACTACTTATATAGTTGAAACTGTAGGATGTTTACTATCACACAAAACACGGT[A/T]
TTTTTTTTCTTTTCCAATTAGAATCTTACTAAAAACTCTGTTGTCTTTTATGTTTGAAACACTTCGTCAACTATAGTGACATAAGCTTAGCAGCACACTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.70% 21.10% 0.11% 0.11% NA
All Indica  2759 69.20% 30.50% 0.14% 0.18% NA
All Japonica  1512 98.70% 1.30% 0.00% 0.00% NA
Aus  269 52.00% 47.60% 0.37% 0.00% NA
Indica I  595 67.40% 32.10% 0.34% 0.17% NA
Indica II  465 76.80% 22.40% 0.22% 0.65% NA
Indica III  913 66.00% 34.00% 0.00% 0.00% NA
Indica Intermediate  786 69.60% 30.20% 0.13% 0.13% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 96.60% 3.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 91.10% 8.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0204076184 T -> A LOC_Os02g07780.2 3_prime_UTR_variant ; 311.0bp to feature; MODIFIER silent_mutation Average:49.755; most accessible tissue: Callus, score: 72.367 N N N N
vg0204076184 T -> A LOC_Os02g07790.1 downstream_gene_variant ; 2195.0bp to feature; MODIFIER silent_mutation Average:49.755; most accessible tissue: Callus, score: 72.367 N N N N
vg0204076184 T -> A LOC_Os02g07780.1 intron_variant ; MODIFIER silent_mutation Average:49.755; most accessible tissue: Callus, score: 72.367 N N N N
vg0204076184 T -> DEL N N silent_mutation Average:49.755; most accessible tissue: Callus, score: 72.367 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0204076184 NA 5.75E-09 mr1141 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204076184 NA 5.15E-06 mr1192 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204076184 NA 1.61E-07 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204076184 NA 1.96E-07 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204076184 NA 8.27E-07 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204076184 NA 7.62E-06 mr1358_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204076184 NA 6.66E-07 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204076184 NA 7.60E-08 mr1566_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204076184 NA 8.00E-06 mr1566_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204076184 NA 6.76E-08 mr1654_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204076184 NA 6.32E-11 mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204076184 NA 8.81E-10 mr1739_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251