\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0203416075:

Variant ID: vg0203416075 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 3416075
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.67, G: 0.33, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


CTGAAAATATGCCTGCCTGCACAATTCAGATACCAAAGTTAAAATAACCAGTCGAGTTGGAGAAACTATTTGCCGGACTCAACTCAAATTGATTATTATG[G/T]
TGCGCATGTAATGAGGGCAGTACTTGTCAGCAGGCATGCAGCAGCATTACTGATAGTCAAACAATGAGAAGTTAGATGCAAGAAGTTTCTGATAACAAAA

Reverse complement sequence

TTTTGTTATCAGAAACTTCTTGCATCTAACTTCTCATTGTTTGACTATCAGTAATGCTGCTGCATGCCTGCTGACAAGTACTGCCCTCATTACATGCGCA[C/A]
CATAATAATCAATTTGAGTTGAGTCCGGCAAATAGTTTCTCCAACTCGACTGGTTATTTTAACTTTGGTATCTGAATTGTGCAGGCAGGCATATTTTCAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 17.10% 13.30% 0.59% 69.04% NA
All Indica  2759 4.90% 3.50% 0.72% 90.90% NA
All Japonica  1512 40.50% 20.90% 0.26% 38.36% NA
Aus  269 11.90% 73.60% 0.00% 14.50% NA
Indica I  595 9.20% 0.30% 1.18% 89.24% NA
Indica II  465 1.90% 0.90% 0.22% 96.99% NA
Indica III  913 3.00% 5.70% 0.33% 91.02% NA
Indica Intermediate  786 5.50% 5.00% 1.15% 88.42% NA
Temperate Japonica  767 37.90% 33.10% 0.39% 28.55% NA
Tropical Japonica  504 52.80% 1.40% 0.20% 45.63% NA
Japonica Intermediate  241 22.80% 22.80% 0.00% 54.36% NA
VI/Aromatic  96 5.20% 2.10% 2.08% 90.62% NA
Intermediate  90 25.60% 17.80% 2.22% 54.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0203416075 G -> T LOC_Os02g06760.1 downstream_gene_variant ; 770.0bp to feature; MODIFIER silent_mutation Average:12.529; most accessible tissue: Callus, score: 77.9 N N N N
vg0203416075 G -> T LOC_Os02g06779.1 downstream_gene_variant ; 4097.0bp to feature; MODIFIER silent_mutation Average:12.529; most accessible tissue: Callus, score: 77.9 N N N N
vg0203416075 G -> T LOC_Os02g06760.2 downstream_gene_variant ; 771.0bp to feature; MODIFIER silent_mutation Average:12.529; most accessible tissue: Callus, score: 77.9 N N N N
vg0203416075 G -> T LOC_Os02g06760.3 downstream_gene_variant ; 770.0bp to feature; MODIFIER silent_mutation Average:12.529; most accessible tissue: Callus, score: 77.9 N N N N
vg0203416075 G -> T LOC_Os02g06770.1 intron_variant ; MODIFIER silent_mutation Average:12.529; most accessible tissue: Callus, score: 77.9 N N N N
vg0203416075 G -> T LOC_Os02g06770.2 intron_variant ; MODIFIER silent_mutation Average:12.529; most accessible tissue: Callus, score: 77.9 N N N N
vg0203416075 G -> T LOC_Os02g06770.3 intron_variant ; MODIFIER silent_mutation Average:12.529; most accessible tissue: Callus, score: 77.9 N N N N
vg0203416075 G -> DEL N N silent_mutation Average:12.529; most accessible tissue: Callus, score: 77.9 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0203416075 NA 8.87E-06 mr1897 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203416075 NA 6.49E-09 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203416075 NA 3.52E-07 mr1446_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203416075 NA 6.59E-06 mr1446_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203416075 NA 4.21E-06 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203416075 NA 1.00E-08 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251