\
| Variant ID: vg0203416075 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 3416075 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.67, G: 0.33, others allele: 0.00, population size: 218. )
CTGAAAATATGCCTGCCTGCACAATTCAGATACCAAAGTTAAAATAACCAGTCGAGTTGGAGAAACTATTTGCCGGACTCAACTCAAATTGATTATTATG[G/T]
TGCGCATGTAATGAGGGCAGTACTTGTCAGCAGGCATGCAGCAGCATTACTGATAGTCAAACAATGAGAAGTTAGATGCAAGAAGTTTCTGATAACAAAA
TTTTGTTATCAGAAACTTCTTGCATCTAACTTCTCATTGTTTGACTATCAGTAATGCTGCTGCATGCCTGCTGACAAGTACTGCCCTCATTACATGCGCA[C/A]
CATAATAATCAATTTGAGTTGAGTCCGGCAAATAGTTTCTCCAACTCGACTGGTTATTTTAACTTTGGTATCTGAATTGTGCAGGCAGGCATATTTTCAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 17.10% | 13.30% | 0.59% | 69.04% | NA |
| All Indica | 2759 | 4.90% | 3.50% | 0.72% | 90.90% | NA |
| All Japonica | 1512 | 40.50% | 20.90% | 0.26% | 38.36% | NA |
| Aus | 269 | 11.90% | 73.60% | 0.00% | 14.50% | NA |
| Indica I | 595 | 9.20% | 0.30% | 1.18% | 89.24% | NA |
| Indica II | 465 | 1.90% | 0.90% | 0.22% | 96.99% | NA |
| Indica III | 913 | 3.00% | 5.70% | 0.33% | 91.02% | NA |
| Indica Intermediate | 786 | 5.50% | 5.00% | 1.15% | 88.42% | NA |
| Temperate Japonica | 767 | 37.90% | 33.10% | 0.39% | 28.55% | NA |
| Tropical Japonica | 504 | 52.80% | 1.40% | 0.20% | 45.63% | NA |
| Japonica Intermediate | 241 | 22.80% | 22.80% | 0.00% | 54.36% | NA |
| VI/Aromatic | 96 | 5.20% | 2.10% | 2.08% | 90.62% | NA |
| Intermediate | 90 | 25.60% | 17.80% | 2.22% | 54.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0203416075 | G -> T | LOC_Os02g06760.1 | downstream_gene_variant ; 770.0bp to feature; MODIFIER | silent_mutation | Average:12.529; most accessible tissue: Callus, score: 77.9 | N | N | N | N |
| vg0203416075 | G -> T | LOC_Os02g06779.1 | downstream_gene_variant ; 4097.0bp to feature; MODIFIER | silent_mutation | Average:12.529; most accessible tissue: Callus, score: 77.9 | N | N | N | N |
| vg0203416075 | G -> T | LOC_Os02g06760.2 | downstream_gene_variant ; 771.0bp to feature; MODIFIER | silent_mutation | Average:12.529; most accessible tissue: Callus, score: 77.9 | N | N | N | N |
| vg0203416075 | G -> T | LOC_Os02g06760.3 | downstream_gene_variant ; 770.0bp to feature; MODIFIER | silent_mutation | Average:12.529; most accessible tissue: Callus, score: 77.9 | N | N | N | N |
| vg0203416075 | G -> T | LOC_Os02g06770.1 | intron_variant ; MODIFIER | silent_mutation | Average:12.529; most accessible tissue: Callus, score: 77.9 | N | N | N | N |
| vg0203416075 | G -> T | LOC_Os02g06770.2 | intron_variant ; MODIFIER | silent_mutation | Average:12.529; most accessible tissue: Callus, score: 77.9 | N | N | N | N |
| vg0203416075 | G -> T | LOC_Os02g06770.3 | intron_variant ; MODIFIER | silent_mutation | Average:12.529; most accessible tissue: Callus, score: 77.9 | N | N | N | N |
| vg0203416075 | G -> DEL | N | N | silent_mutation | Average:12.529; most accessible tissue: Callus, score: 77.9 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0203416075 | NA | 8.87E-06 | mr1897 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203416075 | NA | 6.49E-09 | mr1010_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203416075 | NA | 3.52E-07 | mr1446_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203416075 | NA | 6.59E-06 | mr1446_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203416075 | NA | 4.21E-06 | mr1655_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203416075 | NA | 1.00E-08 | mr1709_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |