Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0203033050:

Variant ID: vg0203033050 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 3033050
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.84, T: 0.15, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

TGTCCGTATACGTAAAAAAAAATTTGGACACGAACTTTTTTTTTGAGGGAATGCCATTTGTCAAGCTTTATTGATCATTAAACATTGTTACATCGTTTGC[C/T]
AAGGTGCTTAGAATATAATCAGGAGGTTCATCGTTTGCCAAAGTGCTTATAATATAAAATTTGGACACGAACTAAACACAGCAACTGTCTCCTGCCCTTG

Reverse complement sequence

CAAGGGCAGGAGACAGTTGCTGTGTTTAGTTCGTGTCCAAATTTTATATTATAAGCACTTTGGCAAACGATGAACCTCCTGATTATATTCTAAGCACCTT[G/A]
GCAAACGATGTAACAATGTTTAATGATCAATAAAGCTTGACAAATGGCATTCCCTCAAAAAAAAAGTTCGTGTCCAAATTTTTTTTTACGTATACGGACA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	41.70%	28.00%	0.40%	29.83%	NA
All Indica	2759	47.70%	9.50%	0.54%	42.26%	NA
All Japonica	1512	38.20%	61.20%	0.07%	0.53%	NA
Aus	269	16.70%	0.70%	0.37%	82.16%	NA
Indica I	595	65.90%	3.70%	0.50%	29.92%	NA
Indica II	465	64.10%	3.40%	0.86%	31.61%	NA
Indica III	913	27.90%	14.30%	0.11%	57.61%	NA
Indica Intermediate	786	47.10%	12.00%	0.89%	40.08%	NA
Temperate Japonica	767	15.80%	84.00%	0.00%	0.26%	NA
Tropical Japonica	504	79.40%	19.20%	0.20%	1.19%	NA
Japonica Intermediate	241	23.20%	76.80%	0.00%	0.00%	NA
VI/Aromatic	96	0.00%	96.90%	0.00%	3.12%	NA
Intermediate	90	38.90%	45.60%	2.22%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0203033050	C -> T	LOC_Os02g06070.1	upstream_gene_variant ; 1937.0bp to feature; MODIFIER	silent_mutation	Average:29.189; most accessible tissue: Callus, score: 66.803	N	N	N	N
vg0203033050	C -> T	LOC_Os02g06090.1	upstream_gene_variant ; 4175.0bp to feature; MODIFIER	silent_mutation	Average:29.189; most accessible tissue: Callus, score: 66.803	N	N	N	N
vg0203033050	C -> T	LOC_Os02g06080.1	downstream_gene_variant ; 989.0bp to feature; MODIFIER	silent_mutation	Average:29.189; most accessible tissue: Callus, score: 66.803	N	N	N	N
vg0203033050	C -> T	LOC_Os02g06070-LOC_Os02g06080	intergenic_region ; MODIFIER	silent_mutation	Average:29.189; most accessible tissue: Callus, score: 66.803	N	N	N	N
vg0203033050	C -> DEL	N	N	silent_mutation	Average:29.189; most accessible tissue: Callus, score: 66.803	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0203033050	NA	2.43E-06	mr1015	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203033050	1.47E-06	1.32E-08	mr1029	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203033050	NA	2.11E-07	mr1047	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203033050	NA	1.41E-08	mr1157	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203033050	4.28E-06	4.28E-06	mr1189	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203033050	NA	6.02E-08	mr1328	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203033050	NA	2.64E-10	mr1446	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203033050	NA	2.66E-07	mr1471	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203033050	NA	1.85E-06	mr1530	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203033050	NA	1.13E-08	mr1539	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203033050	NA	1.05E-11	mr1540	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203033050	NA	1.62E-06	mr1625	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203033050	NA	2.38E-07	mr1642	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203033050	8.56E-06	2.30E-07	mr1725	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203033050	NA	5.86E-13	mr1732	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203033050	NA	2.74E-07	mr1870	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203033050	NA	1.20E-07	mr1401_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203033050	NA	1.28E-06	mr1446_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203033050	NA	3.88E-06	mr1606_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251