\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0203016808:

Variant ID: vg0203016808 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 3016808
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTGTGGGTATCGGGTCTTGGCGTCCCGGAGGGCCTCACTAACAAAGTAGACAGGCCGCTGCACCTTTCGGCGGGGCCGATCCTCTTCTCTAGGGGCCGTA[C/T]
CCCCGGGGCATTCTTCGTCCAAGTGGCCCCTCGGGGCGCACTCGTCTTCTGTGCCGATGACCTCGGGGTCGGAGGACGACAGGAGCGGCCTTCCCACAGT

Reverse complement sequence

ACTGTGGGAAGGCCGCTCCTGTCGTCCTCCGACCCCGAGGTCATCGGCACAGAAGACGAGTGCGCCCCGAGGGGCCACTTGGACGAAGAATGCCCCGGGG[G/A]
TACGGCCCCTAGAGAAGAGGATCGGCCCCGCCGAAAGGTGCAGCGGCCTGTCTACTTTGTTAGTGAGGCCCTCCGGGACGCCAAGACCCGATACCCACAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 31.00% 1.00% 12.51% 55.48% NA
All Indica  2759 13.20% 1.60% 18.30% 66.94% NA
All Japonica  1512 65.90% 0.10% 2.91% 31.08% NA
Aus  269 3.30% 0.00% 4.09% 92.57% NA
Indica I  595 10.10% 1.50% 18.49% 69.92% NA
Indica II  465 28.80% 2.80% 16.56% 51.83% NA
Indica III  913 5.50% 0.50% 18.40% 75.58% NA
Indica Intermediate  786 15.10% 2.20% 19.08% 63.61% NA
Temperate Japonica  767 90.50% 0.00% 1.17% 8.34% NA
Tropical Japonica  504 21.60% 0.40% 5.95% 72.02% NA
Japonica Intermediate  241 80.10% 0.00% 2.07% 17.84% NA
VI/Aromatic  96 63.50% 0.00% 20.83% 15.62% NA
Intermediate  90 42.20% 0.00% 12.22% 45.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0203016808 C -> T LOC_Os02g06050.1 missense_variant ; p.Gly1301Asp; MODERATE nonsynonymous_codon ; G1301D Average:12.836; most accessible tissue: Minghui63 panicle, score: 16.27 benign -0.353 TOLERATED 1.00
vg0203016808 C -> DEL LOC_Os02g06050.1 N frameshift_variant Average:12.836; most accessible tissue: Minghui63 panicle, score: 16.27 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0203016808 NA 1.14E-09 mr1364 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203016808 NA 1.36E-10 mr1443 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203016808 NA 7.45E-07 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203016808 NA 7.06E-06 mr1578 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203016808 NA 1.89E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203016808 NA 3.21E-06 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203016808 NA 3.60E-08 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203016808 NA 2.13E-08 mr1308_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203016808 NA 6.93E-07 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203016808 NA 1.86E-08 mr1401_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203016808 NA 1.21E-06 mr1449_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203016808 NA 2.77E-08 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203016808 NA 6.35E-06 mr1575_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203016808 NA 1.19E-09 mr1584_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203016808 NA 6.56E-08 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203016808 NA 7.72E-07 mr1853_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203016808 NA 5.08E-07 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251