Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0202719681:

Variant ID: vg0202719681 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 2719681
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.53, A: 0.47, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:

CCTCAAACCACTGACAATGAGCCCAAAATTTTGATGAATTGACCATTTTATAAAACTTATTTTAAAAATAACACATGTCAAAAACTAATTTCATAAATAA[G/A]
CCGTGACAACAGCGGGTCATGCAGGTACCCAAGGAGAGGTCTTCGGGCCATGCGGCATAGGGTGGACCACAAGCTCTAGGCCCACGTGGCTATCTTGTAA

Reverse complement sequence

TTACAAGATAGCCACGTGGGCCTAGAGCTTGTGGTCCACCCTATGCCGCATGGCCCGAAGACCTCTCCTTGGGTACCTGCATGACCCGCTGTTGTCACGG[C/T]
TTATTTATGAAATTAGTTTTTGACATGTGTTATTTTTAAAATAAGTTTTATAAAATGGTCAATTCATCAAAATTTTGGGCTCATTGTCAGTGGTTTGAGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	33.40%	8.70%	0.49%	57.49%	NA
All Indica	2759	6.30%	3.60%	0.69%	89.34%	NA
All Japonica	1512	86.30%	12.90%	0.07%	0.73%	NA
Aus	269	18.20%	2.20%	0.74%	78.81%	NA
Indica I	595	11.10%	0.00%	0.50%	88.40%	NA
Indica II	465	2.20%	1.50%	0.65%	95.70%	NA
Indica III	913	6.40%	5.30%	0.66%	87.73%	NA
Indica Intermediate	786	5.20%	5.70%	0.89%	88.17%	NA
Temperate Japonica	767	80.30%	19.40%	0.00%	0.26%	NA
Tropical Japonica	504	98.20%	0.40%	0.00%	1.39%	NA
Japonica Intermediate	241	80.50%	18.30%	0.41%	0.83%	NA
VI/Aromatic	96	0.00%	95.80%	1.04%	3.12%	NA
Intermediate	90	53.30%	17.80%	0.00%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0202719681	G -> A	LOC_Os02g05600.1	upstream_gene_variant ; 2455.0bp to feature; MODIFIER	silent_mutation	Average:30.157; most accessible tissue: Callus, score: 64.387	N	N	N	N
vg0202719681	G -> A	LOC_Os02g05590-LOC_Os02g05600	intergenic_region ; MODIFIER	silent_mutation	Average:30.157; most accessible tissue: Callus, score: 64.387	N	N	N	N
vg0202719681	G -> DEL	N	N	silent_mutation	Average:30.157; most accessible tissue: Callus, score: 64.387	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0202719681	7.62E-11	NA	mr1210	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202719681	2.81E-08	1.56E-11	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202719681	1.69E-10	NA	mr1305	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202719681	9.12E-08	2.25E-10	mr1305	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202719681	1.73E-06	NA	mr1409	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202719681	3.31E-10	3.31E-10	mr1409	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202719681	NA	9.81E-07	mr1515	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202719681	4.41E-07	6.66E-13	mr1585	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202719681	NA	1.79E-09	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202719681	1.69E-09	NA	mr1586	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202719681	2.84E-06	2.88E-09	mr1586	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202719681	5.73E-06	NA	mr1765	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202719681	NA	2.27E-07	mr1765	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202719681	NA	1.67E-06	mr1788	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202719681	1.90E-08	NA	mr1793	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202719681	5.76E-06	7.24E-07	mr1793	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202719681	NA	7.38E-08	mr1057_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202719681	3.03E-06	3.03E-06	mr1166_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202719681	2.53E-09	NA	mr1305_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202719681	2.19E-08	4.88E-12	mr1305_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202719681	8.75E-06	2.74E-08	mr1409_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202719681	1.83E-06	2.62E-07	mr1559_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202719681	1.85E-06	2.96E-08	mr1559_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202719681	6.06E-09	2.63E-16	mr1585_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202719681	6.13E-07	4.76E-13	mr1585_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202719681	8.67E-06	8.67E-06	mr1649_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202719681	NA	1.02E-06	mr1765_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202719681	2.66E-07	NA	mr1793_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202719681	6.95E-07	9.14E-09	mr1793_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251