\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0202719681:

Variant ID: vg0202719681 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 2719681
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.53, A: 0.47, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:


CCTCAAACCACTGACAATGAGCCCAAAATTTTGATGAATTGACCATTTTATAAAACTTATTTTAAAAATAACACATGTCAAAAACTAATTTCATAAATAA[G/A]
CCGTGACAACAGCGGGTCATGCAGGTACCCAAGGAGAGGTCTTCGGGCCATGCGGCATAGGGTGGACCACAAGCTCTAGGCCCACGTGGCTATCTTGTAA

Reverse complement sequence

TTACAAGATAGCCACGTGGGCCTAGAGCTTGTGGTCCACCCTATGCCGCATGGCCCGAAGACCTCTCCTTGGGTACCTGCATGACCCGCTGTTGTCACGG[C/T]
TTATTTATGAAATTAGTTTTTGACATGTGTTATTTTTAAAATAAGTTTTATAAAATGGTCAATTCATCAAAATTTTGGGCTCATTGTCAGTGGTTTGAGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.40% 8.70% 0.49% 57.49% NA
All Indica  2759 6.30% 3.60% 0.69% 89.34% NA
All Japonica  1512 86.30% 12.90% 0.07% 0.73% NA
Aus  269 18.20% 2.20% 0.74% 78.81% NA
Indica I  595 11.10% 0.00% 0.50% 88.40% NA
Indica II  465 2.20% 1.50% 0.65% 95.70% NA
Indica III  913 6.40% 5.30% 0.66% 87.73% NA
Indica Intermediate  786 5.20% 5.70% 0.89% 88.17% NA
Temperate Japonica  767 80.30% 19.40% 0.00% 0.26% NA
Tropical Japonica  504 98.20% 0.40% 0.00% 1.39% NA
Japonica Intermediate  241 80.50% 18.30% 0.41% 0.83% NA
VI/Aromatic  96 0.00% 95.80% 1.04% 3.12% NA
Intermediate  90 53.30% 17.80% 0.00% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0202719681 G -> A LOC_Os02g05600.1 upstream_gene_variant ; 2455.0bp to feature; MODIFIER silent_mutation Average:30.157; most accessible tissue: Callus, score: 64.387 N N N N
vg0202719681 G -> A LOC_Os02g05590-LOC_Os02g05600 intergenic_region ; MODIFIER silent_mutation Average:30.157; most accessible tissue: Callus, score: 64.387 N N N N
vg0202719681 G -> DEL N N silent_mutation Average:30.157; most accessible tissue: Callus, score: 64.387 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0202719681 7.62E-11 NA mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202719681 2.81E-08 1.56E-11 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202719681 1.69E-10 NA mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202719681 9.12E-08 2.25E-10 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202719681 1.73E-06 NA mr1409 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202719681 3.31E-10 3.31E-10 mr1409 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202719681 NA 9.81E-07 mr1515 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202719681 4.41E-07 6.66E-13 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202719681 NA 1.79E-09 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202719681 1.69E-09 NA mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202719681 2.84E-06 2.88E-09 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202719681 5.73E-06 NA mr1765 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202719681 NA 2.27E-07 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202719681 NA 1.67E-06 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202719681 1.90E-08 NA mr1793 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202719681 5.76E-06 7.24E-07 mr1793 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202719681 NA 7.38E-08 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202719681 3.03E-06 3.03E-06 mr1166_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202719681 2.53E-09 NA mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202719681 2.19E-08 4.88E-12 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202719681 8.75E-06 2.74E-08 mr1409_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202719681 1.83E-06 2.62E-07 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202719681 1.85E-06 2.96E-08 mr1559_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202719681 6.06E-09 2.63E-16 mr1585_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202719681 6.13E-07 4.76E-13 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202719681 8.67E-06 8.67E-06 mr1649_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202719681 NA 1.02E-06 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202719681 2.66E-07 NA mr1793_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202719681 6.95E-07 9.14E-09 mr1793_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251