\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0200658088:

Variant ID: vg0200658088 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 658088
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, A: 0.06, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:


CCCCCGAGGGGAGTCAAGCCCGAGGTGTCACACCCCAATCTGGCACCGTCGTACAACGGCACCTGATAGGAGCGTGTCGTAGGAAAAACGGTGCAAACCG[C/A]
TCCCTACGAAACCGCGATCTCAGTACCAGTCCCAGGACATAGCGCTGGTACCCACGGTGACAAATATGAATCATTGCAATCCTTAAAATAAATAGAGGAC

Reverse complement sequence

GTCCTCTATTTATTTTAAGGATTGCAATGATTCATATTTGTCACCGTGGGTACCAGCGCTATGTCCTGGGACTGGTACTGAGATCGCGGTTTCGTAGGGA[G/T]
CGGTTTGCACCGTTTTTCCTACGACACGCTCCTATCAGGTGCCGTTGTACGACGGTGCCAGATTGGGGTGTGACACCTCGGGCTTGACTCCCCTCGGGGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.40% 6.80% 0.00% 1.80% NA
All Indica  2759 91.20% 8.80% 0.00% 0.00% NA
All Japonica  1512 99.00% 0.50% 0.00% 0.53% NA
Aus  269 74.70% 7.80% 0.00% 17.47% NA
Indica I  595 93.60% 6.40% 0.00% 0.00% NA
Indica II  465 80.00% 20.00% 0.00% 0.00% NA
Indica III  913 98.70% 1.30% 0.00% 0.00% NA
Indica Intermediate  786 87.40% 12.60% 0.00% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.00% 0.40% 0.00% 0.60% NA
Japonica Intermediate  241 96.70% 1.20% 0.00% 2.07% NA
VI/Aromatic  96 30.20% 43.80% 0.00% 26.04% NA
Intermediate  90 84.40% 10.00% 0.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0200658088 C -> A LOC_Os02g02170.1 downstream_gene_variant ; 843.0bp to feature; MODIFIER silent_mutation Average:43.262; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg0200658088 C -> A LOC_Os02g02180.1 downstream_gene_variant ; 1602.0bp to feature; MODIFIER silent_mutation Average:43.262; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg0200658088 C -> A LOC_Os02g02170-LOC_Os02g02180 intergenic_region ; MODIFIER silent_mutation Average:43.262; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg0200658088 C -> DEL N N silent_mutation Average:43.262; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0200658088 NA 2.03E-06 mr1046 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200658088 NA 4.80E-06 mr1049 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200658088 4.16E-06 NA mr1352 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200658088 3.88E-07 3.88E-07 mr1421 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200658088 7.94E-06 1.32E-06 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200658088 7.31E-07 7.31E-07 mr1452 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200658088 5.46E-06 1.69E-06 mr1513 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200658088 NA 5.18E-07 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200658088 NA 6.41E-07 mr1743 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200658088 9.62E-06 9.61E-06 mr1894 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200658088 NA 9.84E-06 mr1958 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200658088 NA 2.69E-06 mr1964 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200658088 1.66E-06 NA mr1968 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251