Variant ID: vg0200658088 (JBrowse) | Variation Type: SNP |
Chromosome: chr02 | Position: 658088 |
Reference Allele: C | Alternative Allele: A |
Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, A: 0.06, others allele: 0.00, population size: 72. )
CCCCCGAGGGGAGTCAAGCCCGAGGTGTCACACCCCAATCTGGCACCGTCGTACAACGGCACCTGATAGGAGCGTGTCGTAGGAAAAACGGTGCAAACCG[C/A]
TCCCTACGAAACCGCGATCTCAGTACCAGTCCCAGGACATAGCGCTGGTACCCACGGTGACAAATATGAATCATTGCAATCCTTAAAATAAATAGAGGAC
GTCCTCTATTTATTTTAAGGATTGCAATGATTCATATTTGTCACCGTGGGTACCAGCGCTATGTCCTGGGACTGGTACTGAGATCGCGGTTTCGTAGGGA[G/T]
CGGTTTGCACCGTTTTTCCTACGACACGCTCCTATCAGGTGCCGTTGTACGACGGTGCCAGATTGGGGTGTGACACCTCGGGCTTGACTCCCCTCGGGGG
Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 91.40% | 6.80% | 0.00% | 1.80% | NA |
All Indica | 2759 | 91.20% | 8.80% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 99.00% | 0.50% | 0.00% | 0.53% | NA |
Aus | 269 | 74.70% | 7.80% | 0.00% | 17.47% | NA |
Indica I | 595 | 93.60% | 6.40% | 0.00% | 0.00% | NA |
Indica II | 465 | 80.00% | 20.00% | 0.00% | 0.00% | NA |
Indica III | 913 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 87.40% | 12.60% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 99.00% | 0.40% | 0.00% | 0.60% | NA |
Japonica Intermediate | 241 | 96.70% | 1.20% | 0.00% | 2.07% | NA |
VI/Aromatic | 96 | 30.20% | 43.80% | 0.00% | 26.04% | NA |
Intermediate | 90 | 84.40% | 10.00% | 0.00% | 5.56% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0200658088 | C -> A | LOC_Os02g02170.1 | downstream_gene_variant ; 843.0bp to feature; MODIFIER | silent_mutation | Average:43.262; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
vg0200658088 | C -> A | LOC_Os02g02180.1 | downstream_gene_variant ; 1602.0bp to feature; MODIFIER | silent_mutation | Average:43.262; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
vg0200658088 | C -> A | LOC_Os02g02170-LOC_Os02g02180 | intergenic_region ; MODIFIER | silent_mutation | Average:43.262; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
vg0200658088 | C -> DEL | N | N | silent_mutation | Average:43.262; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0200658088 | NA | 2.03E-06 | mr1046 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0200658088 | NA | 4.80E-06 | mr1049 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0200658088 | 4.16E-06 | NA | mr1352 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0200658088 | 3.88E-07 | 3.88E-07 | mr1421 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0200658088 | 7.94E-06 | 1.32E-06 | mr1432 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0200658088 | 7.31E-07 | 7.31E-07 | mr1452 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0200658088 | 5.46E-06 | 1.69E-06 | mr1513 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0200658088 | NA | 5.18E-07 | mr1704 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0200658088 | NA | 6.41E-07 | mr1743 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0200658088 | 9.62E-06 | 9.61E-06 | mr1894 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0200658088 | NA | 9.84E-06 | mr1958 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0200658088 | NA | 2.69E-06 | mr1964 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0200658088 | 1.66E-06 | NA | mr1968 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |