\
| Variant ID: vg0200529411 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 529411 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 250. )
AAGTTTTTACATAAATTTTGAAAATAATAAAGACAACTAATAACATCAAACTAATTTACCTTGCTTTTATGAGAATAGAGTTTCCTTTTCATTCCATTTA[G/A]
AACATTATCTCTATATATCTCAAGCAAGGCTGAATCCAACTTATTTTTGAAATCAACATCTACTGTTTCGGTTTATTTTCTCTATCAAAAATAAGAGAAT
ATTCTCTTATTTTTGATAGAGAAAATAAACCGAAACAGTAGATGTTGATTTCAAAAATAAGTTGGATTCAGCCTTGCTTGAGATATATAGAGATAATGTT[C/T]
TAAATGGAATGAAAAGGAAACTCTATTCTCATAAAAGCAAGGTAAATTAGTTTGATGTTATTAGTTGTCTTTATTATTTTCAAAATTTATGTAAAAACTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.90% | 4.40% | 4.27% | 1.40% | NA |
| All Indica | 2759 | 82.90% | 7.40% | 7.32% | 2.39% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.00% | 0.30% | 0.50% | 0.17% | NA |
| Indica II | 465 | 89.20% | 5.40% | 4.09% | 1.29% | NA |
| Indica III | 913 | 72.20% | 10.60% | 13.25% | 3.94% | NA |
| Indica Intermediate | 786 | 79.40% | 10.20% | 7.51% | 2.93% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0200529411 | G -> A | LOC_Os02g01950-LOC_Os02g01960 | intergenic_region ; MODIFIER | silent_mutation | Average:15.659; most accessible tissue: Minghui63 young leaf, score: 22.423 | N | N | N | N |
| vg0200529411 | G -> DEL | N | N | silent_mutation | Average:15.659; most accessible tissue: Minghui63 young leaf, score: 22.423 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0200529411 | NA | 3.05E-06 | mr1457 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200529411 | NA | 5.34E-06 | mr1215_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200529411 | 6.05E-06 | 6.04E-06 | mr1366_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200529411 | NA | 5.82E-06 | mr1366_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200529411 | NA | 4.88E-06 | mr1376_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200529411 | NA | 6.03E-06 | mr1431_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200529411 | NA | 3.30E-07 | mr1723_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200529411 | NA | 4.45E-06 | mr1743_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200529411 | NA | 8.29E-06 | mr1743_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200529411 | NA | 4.14E-06 | mr1825_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200529411 | NA | 3.91E-07 | mr1924_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0200529411 | NA | 3.55E-09 | mr1943_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |