\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0200529411:

Variant ID: vg0200529411 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 529411
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


AAGTTTTTACATAAATTTTGAAAATAATAAAGACAACTAATAACATCAAACTAATTTACCTTGCTTTTATGAGAATAGAGTTTCCTTTTCATTCCATTTA[G/A]
AACATTATCTCTATATATCTCAAGCAAGGCTGAATCCAACTTATTTTTGAAATCAACATCTACTGTTTCGGTTTATTTTCTCTATCAAAAATAAGAGAAT

Reverse complement sequence

ATTCTCTTATTTTTGATAGAGAAAATAAACCGAAACAGTAGATGTTGATTTCAAAAATAAGTTGGATTCAGCCTTGCTTGAGATATATAGAGATAATGTT[C/T]
TAAATGGAATGAAAAGGAAACTCTATTCTCATAAAAGCAAGGTAAATTAGTTTGATGTTATTAGTTGTCTTTATTATTTTCAAAATTTATGTAAAAACTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.90% 4.40% 4.27% 1.40% NA
All Indica  2759 82.90% 7.40% 7.32% 2.39% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.00% 0.30% 0.50% 0.17% NA
Indica II  465 89.20% 5.40% 4.09% 1.29% NA
Indica III  913 72.20% 10.60% 13.25% 3.94% NA
Indica Intermediate  786 79.40% 10.20% 7.51% 2.93% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0200529411 G -> A LOC_Os02g01950-LOC_Os02g01960 intergenic_region ; MODIFIER silent_mutation Average:15.659; most accessible tissue: Minghui63 young leaf, score: 22.423 N N N N
vg0200529411 G -> DEL N N silent_mutation Average:15.659; most accessible tissue: Minghui63 young leaf, score: 22.423 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0200529411 NA 3.05E-06 mr1457 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200529411 NA 5.34E-06 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200529411 6.05E-06 6.04E-06 mr1366_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200529411 NA 5.82E-06 mr1366_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200529411 NA 4.88E-06 mr1376_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200529411 NA 6.03E-06 mr1431_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200529411 NA 3.30E-07 mr1723_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200529411 NA 4.45E-06 mr1743_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200529411 NA 8.29E-06 mr1743_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200529411 NA 4.14E-06 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200529411 NA 3.91E-07 mr1924_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200529411 NA 3.55E-09 mr1943_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251