Variant ID: vg0200466747 (JBrowse) | Variation Type: SNP |
Chromosome: chr02 | Position: 466747 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.77, T: 0.23, others allele: 0.00, population size: 213. )
TTTGAAATGTATTGTTTTTTATATGGTCATCGGCATATTCTTGTTTGCTAAAGGAAGTATGTTTGATAAATAGTATGTTTCATATCAGAGCTTTTTCCTC[C/T]
AATATCTTGTCATGTATGGCATTTCCAATAGCTTTTCATGGTGTCATCTCGATGGCTTGCATGTATAAGAGATAGACGGGAAGGGCTTGTAACTATAGGG
CCCTATAGTTACAAGCCCTTCCCGTCTATCTCTTATACATGCAAGCCATCGAGATGACACCATGAAAAGCTATTGGAAATGCCATACATGACAAGATATT[G/A]
GAGGAAAAAGCTCTGATATGAAACATACTATTTATCAAACATACTTCCTTTAGCAAACAAGAATATGCCGATGACCATATAAAAAACAATACATTTCAAA
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 58.90% | 25.00% | 7.11% | 8.99% | NA |
All Indica | 2759 | 36.30% | 37.20% | 11.45% | 15.08% | NA |
All Japonica | 1512 | 98.30% | 1.60% | 0.07% | 0.00% | NA |
Aus | 269 | 77.70% | 16.70% | 3.35% | 2.23% | NA |
Indica I | 595 | 11.40% | 65.00% | 8.40% | 15.13% | NA |
Indica II | 465 | 73.30% | 16.30% | 6.02% | 4.30% | NA |
Indica III | 913 | 30.90% | 30.10% | 17.42% | 21.58% | NA |
Indica Intermediate | 786 | 39.40% | 36.60% | 10.05% | 13.87% | NA |
Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 96.70% | 2.90% | 0.41% | 0.00% | NA |
VI/Aromatic | 96 | 29.20% | 62.50% | 8.33% | 0.00% | NA |
Intermediate | 90 | 66.70% | 27.80% | 2.22% | 3.33% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0200466747 | C -> T | LOC_Os02g01840.1 | downstream_gene_variant ; 1764.0bp to feature; MODIFIER | silent_mutation | Average:36.63; most accessible tissue: Callus, score: 79.603 | N | N | N | N |
vg0200466747 | C -> T | LOC_Os02g01850.1 | downstream_gene_variant ; 3743.0bp to feature; MODIFIER | silent_mutation | Average:36.63; most accessible tissue: Callus, score: 79.603 | N | N | N | N |
vg0200466747 | C -> T | LOC_Os02g01840-LOC_Os02g01850 | intergenic_region ; MODIFIER | silent_mutation | Average:36.63; most accessible tissue: Callus, score: 79.603 | N | N | N | N |
vg0200466747 | C -> DEL | N | N | silent_mutation | Average:36.63; most accessible tissue: Callus, score: 79.603 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0200466747 | NA | 2.67E-06 | mr1298 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0200466747 | NA | 2.42E-06 | mr1629 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0200466747 | NA | 6.60E-08 | mr1677 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0200466747 | NA | 4.83E-06 | mr1677 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0200466747 | NA | 3.96E-06 | mr1835 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0200466747 | NA | 8.48E-07 | mr1974 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0200466747 | NA | 1.47E-07 | mr1399_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0200466747 | NA | 4.07E-13 | mr1557_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0200466747 | NA | 1.58E-09 | mr1598_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0200466747 | NA | 3.17E-14 | mr1904_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0200466747 | NA | 7.19E-07 | mr1904_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0200466747 | NA | 1.29E-07 | mr1910_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |