\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0200466747:

Variant ID: vg0200466747 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 466747
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.77, T: 0.23, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


TTTGAAATGTATTGTTTTTTATATGGTCATCGGCATATTCTTGTTTGCTAAAGGAAGTATGTTTGATAAATAGTATGTTTCATATCAGAGCTTTTTCCTC[C/T]
AATATCTTGTCATGTATGGCATTTCCAATAGCTTTTCATGGTGTCATCTCGATGGCTTGCATGTATAAGAGATAGACGGGAAGGGCTTGTAACTATAGGG

Reverse complement sequence

CCCTATAGTTACAAGCCCTTCCCGTCTATCTCTTATACATGCAAGCCATCGAGATGACACCATGAAAAGCTATTGGAAATGCCATACATGACAAGATATT[G/A]
GAGGAAAAAGCTCTGATATGAAACATACTATTTATCAAACATACTTCCTTTAGCAAACAAGAATATGCCGATGACCATATAAAAAACAATACATTTCAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.90% 25.00% 7.11% 8.99% NA
All Indica  2759 36.30% 37.20% 11.45% 15.08% NA
All Japonica  1512 98.30% 1.60% 0.07% 0.00% NA
Aus  269 77.70% 16.70% 3.35% 2.23% NA
Indica I  595 11.40% 65.00% 8.40% 15.13% NA
Indica II  465 73.30% 16.30% 6.02% 4.30% NA
Indica III  913 30.90% 30.10% 17.42% 21.58% NA
Indica Intermediate  786 39.40% 36.60% 10.05% 13.87% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 97.00% 3.00% 0.00% 0.00% NA
Japonica Intermediate  241 96.70% 2.90% 0.41% 0.00% NA
VI/Aromatic  96 29.20% 62.50% 8.33% 0.00% NA
Intermediate  90 66.70% 27.80% 2.22% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0200466747 C -> T LOC_Os02g01840.1 downstream_gene_variant ; 1764.0bp to feature; MODIFIER silent_mutation Average:36.63; most accessible tissue: Callus, score: 79.603 N N N N
vg0200466747 C -> T LOC_Os02g01850.1 downstream_gene_variant ; 3743.0bp to feature; MODIFIER silent_mutation Average:36.63; most accessible tissue: Callus, score: 79.603 N N N N
vg0200466747 C -> T LOC_Os02g01840-LOC_Os02g01850 intergenic_region ; MODIFIER silent_mutation Average:36.63; most accessible tissue: Callus, score: 79.603 N N N N
vg0200466747 C -> DEL N N silent_mutation Average:36.63; most accessible tissue: Callus, score: 79.603 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0200466747 NA 2.67E-06 mr1298 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200466747 NA 2.42E-06 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200466747 NA 6.60E-08 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200466747 NA 4.83E-06 mr1677 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200466747 NA 3.96E-06 mr1835 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200466747 NA 8.48E-07 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200466747 NA 1.47E-07 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200466747 NA 4.07E-13 mr1557_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200466747 NA 1.58E-09 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200466747 NA 3.17E-14 mr1904_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200466747 NA 7.19E-07 mr1904_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200466747 NA 1.29E-07 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251