\
| Variant ID: vg0142802503 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 42802503 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.76, A: 0.24, others allele: 0.00, population size: 222. )
TTCTCGCGCGTCTGCACGAGCTAGGCATTCTCGAAATTTTATGGTCATTATAAAATATCCCAAGGTATCTCAAGTTACTTAACTAGAAAAAGTGCCCGTG[A/C]
TTTGTAACGGGAAGTGTAAAGATCAGAAAATTAAGGAAAAGTTGAGAAAGATTTACATTAGAGTAAAGTGCATTGGCGGTCCTTAATCTTGTAGGGTTGT
ACAACCCTACAAGATTAAGGACCGCCAATGCACTTTACTCTAATGTAAATCTTTCTCAACTTTTCCTTAATTTTCTGATCTTTACACTTCCCGTTACAAA[T/G]
CACGGGCACTTTTTCTAGTTAAGTAACTTGAGATACCTTGGGATATTTTATAATGACCATAAAATTTCGAGAATGCCTAGCTCGTGCAGACGCGCGAGAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.60% | 19.40% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 75.90% | 24.00% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 93.10% | 6.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 50.90% | 49.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 72.80% | 26.90% | 0.34% | 0.00% | NA |
| Indica II | 465 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 63.20% | 36.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 80.70% | 19.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 80.00% | 20.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 18.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0142802503 | A -> C | LOC_Os01g73860.1 | upstream_gene_variant ; 3013.0bp to feature; MODIFIER | silent_mutation | Average:58.977; most accessible tissue: Minghui63 panicle, score: 84.552 | N | N | N | N |
| vg0142802503 | A -> C | LOC_Os01g73870.1 | upstream_gene_variant ; 2399.0bp to feature; MODIFIER | silent_mutation | Average:58.977; most accessible tissue: Minghui63 panicle, score: 84.552 | N | N | N | N |
| vg0142802503 | A -> C | LOC_Os01g73860-LOC_Os01g73870 | intergenic_region ; MODIFIER | silent_mutation | Average:58.977; most accessible tissue: Minghui63 panicle, score: 84.552 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0142802503 | NA | 9.92E-06 | mr1070 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142802503 | NA | 7.41E-08 | mr1180 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142802503 | NA | 2.77E-06 | mr1280 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142802503 | NA | 4.35E-06 | mr1534 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142802503 | NA | 2.06E-06 | mr1627 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142802503 | 4.67E-06 | NA | mr1788 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142802503 | NA | 2.13E-07 | mr1839 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142802503 | NA | 2.64E-06 | mr1277_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142802503 | NA | 7.43E-06 | mr1332_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |