Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142631065:

Variant ID: vg0142631065 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 42631065
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.05, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:

CGGCAATGGATCAGCGCTTACTTCCCCATCCCTGGGAGCGAAAACACATGCCTGACAGAGTGGTGGTTGCAGGCCAGAACATGTTTTCGGAAGTGCTACA[G/A]
GACAAACTTCGACAGCGCTTGTATGCTGATTTGCTGGCAGATTTGGAAGGAAAGAAATGCGCGTGTTTTCGACCAAAGATCGAGAAGCCCTAACCAGTTA

Reverse complement sequence

TAACTGGTTAGGGCTTCTCGATCTTTGGTCGAAAACACGCGCATTTCTTTCCTTCCAAATCTGCCAGCAAATCAGCATACAAGCGCTGTCGAAGTTTGTC[C/T]
TGTAGCACTTCCGAAAACATGTTCTGGCCTGCAACCACCACTCTGTCAGGCATGTGTTTTCGCTCCCAGGGATGGGGAAGTAAGCGCTGATCCATTGCCG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.50%	29.10%	3.53%	6.92%	NA
All Indica	2759	39.40%	48.40%	4.24%	7.94%	NA
All Japonica	1512	91.90%	1.20%	0.93%	5.95%	NA
Aus	269	83.60%	0.00%	11.52%	4.83%	NA
Indica I	595	62.40%	37.10%	0.00%	0.50%	NA
Indica II	465	9.20%	83.90%	1.51%	5.38%	NA
Indica III	913	40.50%	34.90%	8.65%	15.88%	NA
Indica Intermediate	786	38.70%	51.50%	3.94%	5.85%	NA
Temperate Japonica	767	99.20%	0.50%	0.00%	0.26%	NA
Tropical Japonica	504	78.60%	2.20%	2.18%	17.06%	NA
Japonica Intermediate	241	96.70%	1.20%	1.24%	0.83%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	67.80%	22.20%	4.44%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0142631065	G -> A	LOC_Os01g73580.1	downstream_gene_variant ; 625.0bp to feature; MODIFIER	silent_mutation	Average:61.828; most accessible tissue: Minghui63 flag leaf, score: 80.786	N	N	N	N
vg0142631065	G -> A	LOC_Os01g73590.1	downstream_gene_variant ; 4663.0bp to feature; MODIFIER	silent_mutation	Average:61.828; most accessible tissue: Minghui63 flag leaf, score: 80.786	N	N	N	N
vg0142631065	G -> A	LOC_Os01g73580-LOC_Os01g73590	intergenic_region ; MODIFIER	silent_mutation	Average:61.828; most accessible tissue: Minghui63 flag leaf, score: 80.786	N	N	N	N
vg0142631065	G -> DEL	N	N	silent_mutation	Average:61.828; most accessible tissue: Minghui63 flag leaf, score: 80.786	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0142631065	NA	1.23E-18	Plant_height	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0142631065	NA	3.99E-09	mr1174	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142631065	NA	4.33E-06	mr1201	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142631065	NA	2.19E-06	mr1274	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142631065	NA	5.57E-09	mr1608	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142631065	NA	1.89E-07	mr1919	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142631065	NA	2.36E-06	mr1041_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142631065	NA	1.19E-10	mr1174_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142631065	NA	1.41E-20	mr1183_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142631065	NA	4.53E-06	mr1184_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142631065	NA	9.59E-07	mr1274_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142631065	NA	5.55E-06	mr1278_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142631065	NA	1.31E-06	mr1293_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142631065	NA	3.99E-06	mr1294_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142631065	NA	1.72E-06	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142631065	NA	3.91E-07	mr1497_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142631065	NA	7.26E-09	mr1508_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142631065	NA	1.13E-06	mr1508_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142631065	NA	1.24E-07	mr1604_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142631065	NA	8.30E-22	mr1627_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142631065	NA	1.71E-08	mr1627_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142631065	NA	6.76E-06	mr1779_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142631065	NA	5.15E-15	mr1794_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142631065	NA	3.56E-09	mr1851_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142631065	NA	1.70E-06	mr1992_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251