Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0142487665:

Variant ID: vg0142487665 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 42487665
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCGATTTGGGCTCGATTTCACCGCCACAGCCCACTCAACCCCGATCGAGGTCGAACCAAACAAGGAAGAAATAAGTTCATATGAGGTCTCTTAACTTGTC[G/A]
ACGAATCCGAATCCGATTTTCGTCCCTCAACCAGAAAACCAGACACACTGGGTCCCTCAACTATTAAAACCGGTGCAGATTAGGTCCTTGTGGTTTTAAG

Reverse complement sequence

CTTAAAACCACAAGGACCTAATCTGCACCGGTTTTAATAGTTGAGGGACCCAGTGTGTCTGGTTTTCTGGTTGAGGGACGAAAATCGGATTCGGATTCGT[C/T]
GACAAGTTAAGAGACCTCATATGAACTTATTTCTTCCTTGTTTGGTTCGACCTCGATCGGGGTTGAGTGGGCTGTGGCGGTGAAATCGAGCCCAAATCGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.20%	4.10%	0.08%	2.56%	NA
All Indica	2759	98.70%	0.70%	0.04%	0.51%	NA
All Japonica	1512	81.60%	11.40%	0.20%	6.81%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.20%	0.80%	0.00%	0.00%	NA
Indica II	465	98.50%	0.60%	0.22%	0.65%	NA
Indica III	913	98.40%	0.50%	0.00%	1.10%	NA
Indica Intermediate	786	99.00%	0.90%	0.00%	0.13%	NA
Temperate Japonica	767	97.50%	2.30%	0.00%	0.13%	NA
Tropical Japonica	504	53.80%	26.20%	0.60%	19.44%	NA
Japonica Intermediate	241	89.20%	9.10%	0.00%	1.66%	NA
VI/Aromatic	96	99.00%	0.00%	0.00%	1.04%	NA
Intermediate	90	93.30%	3.30%	0.00%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0142487665	G -> A	LOC_Os01g73300.1	upstream_gene_variant ; 4293.0bp to feature; MODIFIER	silent_mutation	Average:98.325; most accessible tissue: Zhenshan97 panicle, score: 99.926	N	N	N	N
vg0142487665	G -> A	LOC_Os01g73310.1	upstream_gene_variant ; 214.0bp to feature; MODIFIER	silent_mutation	Average:98.325; most accessible tissue: Zhenshan97 panicle, score: 99.926	N	N	N	N
vg0142487665	G -> A	LOC_Os01g73310-LOC_Os01g73320	intergenic_region ; MODIFIER	silent_mutation	Average:98.325; most accessible tissue: Zhenshan97 panicle, score: 99.926	N	N	N	N
vg0142487665	G -> DEL	N	N	silent_mutation	Average:98.325; most accessible tissue: Zhenshan97 panicle, score: 99.926	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0142487665	G	A	0.01	0.01	0.0	0.01	0.0	0.0

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0142487665	NA	4.71E-06	mr1221_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142487665	NA	7.06E-07	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142487665	3.29E-06	NA	mr1533_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142487665	NA	8.84E-07	mr1574_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142487665	NA	6.18E-08	mr1659_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142487665	3.39E-06	6.75E-12	mr1806_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142487665	NA	5.75E-09	mr1835_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251