\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142431590:

Variant ID: vg0142431590 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 42431590
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


AATGTTTGTTCTGGACAAATTTAATTAAACGTTAGAAATGTTTACGTCTGTGCAAAGATAAATATTAATCAGTGAATGTTAGAACATACTCCCTCCGTTT[C/T]
ATAATGTAAGTCATTCTTTGATGCCCAATTCTTTGATGTAACCCCTACTCTATCAATATACAAGCAAAGCTTTTACCCTCTTTTCAAGAAAAATAAATAT

Reverse complement sequence

ATATTTATTTTTCTTGAAAAGAGGGTAAAAGCTTTGCTTGTATATTGATAGAGTAGGGGTTACATCAAAGAATTGGGCATCAAAGAATGACTTACATTAT[G/A]
AAACGGAGGGAGTATGTTCTAACATTCACTGATTAATATTTATCTTTGCACAGACGTAAACATTTCTAACGTTTAATTAAATTTGTCCAGAACAAACATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.80% 6.50% 2.16% 6.58% NA
All Indica  2759 87.50% 1.40% 1.41% 9.68% NA
All Japonica  1512 77.20% 17.10% 3.70% 1.98% NA
Aus  269 94.80% 0.70% 1.12% 3.35% NA
Indica I  595 92.10% 4.40% 3.53% 0.00% NA
Indica II  465 67.50% 0.90% 0.65% 30.97% NA
Indica III  913 94.50% 0.00% 0.66% 4.82% NA
Indica Intermediate  786 87.80% 1.00% 1.15% 10.05% NA
Temperate Japonica  767 63.00% 31.40% 5.48% 0.13% NA
Tropical Japonica  504 91.90% 0.20% 2.58% 5.36% NA
Japonica Intermediate  241 91.70% 7.10% 0.41% 0.83% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 82.20% 8.90% 3.33% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0142431590 C -> T LOC_Os01g73160.1 upstream_gene_variant ; 4332.0bp to feature; MODIFIER silent_mutation Average:84.837; most accessible tissue: Zhenshan97 young leaf, score: 96.341 N N N N
vg0142431590 C -> T LOC_Os01g73190.1 upstream_gene_variant ; 4999.0bp to feature; MODIFIER silent_mutation Average:84.837; most accessible tissue: Zhenshan97 young leaf, score: 96.341 N N N N
vg0142431590 C -> T LOC_Os01g73180.1 downstream_gene_variant ; 2311.0bp to feature; MODIFIER silent_mutation Average:84.837; most accessible tissue: Zhenshan97 young leaf, score: 96.341 N N N N
vg0142431590 C -> T LOC_Os01g73170.1 intron_variant ; MODIFIER silent_mutation Average:84.837; most accessible tissue: Zhenshan97 young leaf, score: 96.341 N N N N
vg0142431590 C -> DEL N N silent_mutation Average:84.837; most accessible tissue: Zhenshan97 young leaf, score: 96.341 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0142431590 C T 0.06 0.05 0.02 -0.01 0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0142431590 NA 4.00E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142431590 NA 1.95E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142431590 NA 9.01E-06 mr1788 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142431590 NA 8.44E-06 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142431590 2.54E-06 1.73E-07 mr1821 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142431590 NA 1.39E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142431590 NA 1.54E-06 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142431590 NA 1.68E-06 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251