\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142314165:

Variant ID: vg0142314165 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 42314165
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.72, T: 0.28, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


TTTACGAGTTAATCCCATGAAAATTTGAAATATGTATGGATGGTTCACAAGAAACACAGGGATTTGCTGGCTCGAAGTAAAATAAGATAGAAGTAGAGGG[T/A]
AAAATGAATGATGCATTAGATTTGTTAGAAGGAAAAATAATAATGAAATGACAGTTGAGATCATACATGTTCTTTCTATTGAAATACGTTAAACGAAAGC

Reverse complement sequence

GCTTTCGTTTAACGTATTTCAATAGAAAGAACATGTATGATCTCAACTGTCATTTCATTATTATTTTTCCTTCTAACAAATCTAATGCATCATTCATTTT[A/T]
CCCTCTACTTCTATCTTATTTTACTTCGAGCCAGCAAATCCCTGTGTTTCTTGTGAACCATCCATACATATTTCAAATTTTCATGGGATTAACTCGTAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.40% 27.40% 0.25% 0.00% NA
All Indica  2759 59.90% 39.70% 0.40% 0.00% NA
All Japonica  1512 91.70% 8.30% 0.07% 0.00% NA
Aus  269 82.50% 17.50% 0.00% 0.00% NA
Indica I  595 69.70% 29.90% 0.34% 0.00% NA
Indica II  465 24.50% 74.80% 0.65% 0.00% NA
Indica III  913 67.50% 32.20% 0.33% 0.00% NA
Indica Intermediate  786 64.50% 35.10% 0.38% 0.00% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 77.20% 22.80% 0.00% 0.00% NA
Japonica Intermediate  241 97.10% 2.50% 0.41% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 75.60% 24.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0142314165 T -> A LOC_Os01g72940.1 upstream_gene_variant ; 2988.0bp to feature; MODIFIER silent_mutation Average:36.552; most accessible tissue: Callus, score: 48.324 N N N N
vg0142314165 T -> A LOC_Os01g72960.1 upstream_gene_variant ; 1099.0bp to feature; MODIFIER silent_mutation Average:36.552; most accessible tissue: Callus, score: 48.324 N N N N
vg0142314165 T -> A LOC_Os01g72950.1 downstream_gene_variant ; 588.0bp to feature; MODIFIER silent_mutation Average:36.552; most accessible tissue: Callus, score: 48.324 N N N N
vg0142314165 T -> A LOC_Os01g72950-LOC_Os01g72960 intergenic_region ; MODIFIER silent_mutation Average:36.552; most accessible tissue: Callus, score: 48.324 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0142314165 NA 2.42E-06 mr1322 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142314165 NA 4.25E-11 mr1188_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142314165 NA 2.21E-09 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142314165 NA 3.23E-06 mr1336_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142314165 NA 5.64E-09 mr1438_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142314165 NA 1.05E-07 mr1438_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142314165 NA 6.20E-06 mr1974_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251