\
| Variant ID: vg0142314165 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 42314165 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.72, T: 0.28, others allele: 0.00, population size: 97. )
TTTACGAGTTAATCCCATGAAAATTTGAAATATGTATGGATGGTTCACAAGAAACACAGGGATTTGCTGGCTCGAAGTAAAATAAGATAGAAGTAGAGGG[T/A]
AAAATGAATGATGCATTAGATTTGTTAGAAGGAAAAATAATAATGAAATGACAGTTGAGATCATACATGTTCTTTCTATTGAAATACGTTAAACGAAAGC
GCTTTCGTTTAACGTATTTCAATAGAAAGAACATGTATGATCTCAACTGTCATTTCATTATTATTTTTCCTTCTAACAAATCTAATGCATCATTCATTTT[A/T]
CCCTCTACTTCTATCTTATTTTACTTCGAGCCAGCAAATCCCTGTGTTTCTTGTGAACCATCCATACATATTTCAAATTTTCATGGGATTAACTCGTAAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.40% | 27.40% | 0.25% | 0.00% | NA |
| All Indica | 2759 | 59.90% | 39.70% | 0.40% | 0.00% | NA |
| All Japonica | 1512 | 91.70% | 8.30% | 0.07% | 0.00% | NA |
| Aus | 269 | 82.50% | 17.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 69.70% | 29.90% | 0.34% | 0.00% | NA |
| Indica II | 465 | 24.50% | 74.80% | 0.65% | 0.00% | NA |
| Indica III | 913 | 67.50% | 32.20% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 64.50% | 35.10% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 77.20% | 22.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.10% | 2.50% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 24.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0142314165 | T -> A | LOC_Os01g72940.1 | upstream_gene_variant ; 2988.0bp to feature; MODIFIER | silent_mutation | Average:36.552; most accessible tissue: Callus, score: 48.324 | N | N | N | N |
| vg0142314165 | T -> A | LOC_Os01g72960.1 | upstream_gene_variant ; 1099.0bp to feature; MODIFIER | silent_mutation | Average:36.552; most accessible tissue: Callus, score: 48.324 | N | N | N | N |
| vg0142314165 | T -> A | LOC_Os01g72950.1 | downstream_gene_variant ; 588.0bp to feature; MODIFIER | silent_mutation | Average:36.552; most accessible tissue: Callus, score: 48.324 | N | N | N | N |
| vg0142314165 | T -> A | LOC_Os01g72950-LOC_Os01g72960 | intergenic_region ; MODIFIER | silent_mutation | Average:36.552; most accessible tissue: Callus, score: 48.324 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0142314165 | NA | 2.42E-06 | mr1322 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142314165 | NA | 4.25E-11 | mr1188_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142314165 | NA | 2.21E-09 | mr1322_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142314165 | NA | 3.23E-06 | mr1336_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142314165 | NA | 5.64E-09 | mr1438_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142314165 | NA | 1.05E-07 | mr1438_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142314165 | NA | 6.20E-06 | mr1974_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |