\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142135633:

Variant ID: vg0142135633 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 42135633
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.62, A: 0.37, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


ACTTACATGTTCTGGCTGAAGGTAGTCCATCTCGTTTGTGTAGTGGTAGTAGGCCTAAACAGCTAGTTGCAATGGAGCACTTGTCACGTACGTCTATCCG[C/A]
TCGAGAAACCGATGGATTCATCCATGGCTGCTTCTGCCGCTGCTATCCGATAATCCGTCTACGGCGCTGGGTGCAACGAGCGTACGCGCAGGGCGCGCGC

Reverse complement sequence

GCGCGCGCCCTGCGCGTACGCTCGTTGCACCCAGCGCCGTAGACGGATTATCGGATAGCAGCGGCAGAAGCAGCCATGGATGAATCCATCGGTTTCTCGA[G/T]
CGGATAGACGTACGTGACAAGTGCTCCATTGCAACTAGCTGTTTAGGCCTACTACCACTACACAAACGAGATGGACTACCTTCAGCCAGAACATGTAAGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.10% 45.70% 0.13% 2.05% NA
All Indica  2759 84.50% 14.80% 0.11% 0.65% NA
All Japonica  1512 6.30% 88.40% 0.20% 5.16% NA
Aus  269 1.90% 98.10% 0.00% 0.00% NA
Indica I  595 73.40% 25.00% 0.00% 1.51% NA
Indica II  465 96.60% 3.40% 0.00% 0.00% NA
Indica III  913 87.10% 12.70% 0.11% 0.11% NA
Indica Intermediate  786 82.70% 16.00% 0.25% 1.02% NA
Temperate Japonica  767 0.80% 99.20% 0.00% 0.00% NA
Tropical Japonica  504 16.70% 68.50% 0.20% 14.68% NA
Japonica Intermediate  241 2.10% 95.40% 0.83% 1.66% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 34.40% 64.40% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0142135633 C -> A LOC_Os01g72630.1 upstream_gene_variant ; 3016.0bp to feature; MODIFIER silent_mutation Average:67.706; most accessible tissue: Zhenshan97 panicle, score: 87.126 N N N N
vg0142135633 C -> A LOC_Os01g72620.1 intron_variant ; MODIFIER silent_mutation Average:67.706; most accessible tissue: Zhenshan97 panicle, score: 87.126 N N N N
vg0142135633 C -> DEL N N silent_mutation Average:67.706; most accessible tissue: Zhenshan97 panicle, score: 87.126 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0142135633 NA 8.79E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142135633 NA 3.04E-21 mr1051 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142135633 NA 7.10E-15 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142135633 NA 1.48E-12 mr1169 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142135633 NA 1.20E-29 mr1208 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142135633 NA 2.48E-13 mr1270 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142135633 NA 1.41E-09 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142135633 NA 7.27E-08 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142135633 NA 1.92E-09 mr1342 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142135633 NA 6.17E-10 mr1524 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142135633 NA 9.51E-18 mr1552 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142135633 NA 6.51E-06 mr1568 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142135633 NA 1.55E-08 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142135633 NA 1.73E-13 mr1655 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142135633 NA 8.73E-08 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142135633 NA 1.06E-14 mr1713 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142135633 NA 1.58E-07 mr1717 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142135633 NA 7.97E-07 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142135633 1.57E-06 1.44E-12 mr1770 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142135633 NA 1.64E-07 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142135633 NA 5.36E-09 mr1946 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251