\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0141987444:

Variant ID: vg0141987444 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 41987444
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


CTGAGATGGTTGAGCACGCTTGGTGACCTGAAAGAAGCACCTTGAGACAAGTTCATCAAAAATCCAGGAACCCTTTGCTTCCAGATCCATAGCATCATCA[T/G]
ATGGGATCAGATCGTTAGCCATCCATAATTGAATTAACATATCCTTGTCTATCTTGTGAGTCCTTGGGAATAATGAACAAAAGGCGAAGCATCCTTTAAT

Reverse complement sequence

ATTAAAGGATGCTTCGCCTTTTGTTCATTATTCCCAAGGACTCACAAGATAGACAAGGATATGTTAATTCAATTATGGATGGCTAACGATCTGATCCCAT[A/C]
TGATGATGCTATGGATCTGGAAGCAAAGGGTTCCTGGATTTTTGATGAACTTGTCTCAAGGTGCTTCTTTCAGGTCACCAAGCGTGCTCAACCATCTCAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.80% 31.80% 0.53% 13.82% NA
All Indica  2759 52.20% 25.90% 0.87% 21.02% NA
All Japonica  1512 51.10% 44.70% 0.00% 4.17% NA
Aus  269 67.30% 32.00% 0.00% 0.74% NA
Indica I  595 28.10% 43.00% 0.84% 28.07% NA
Indica II  465 78.30% 11.60% 0.86% 9.25% NA
Indica III  913 58.10% 18.40% 0.66% 22.89% NA
Indica Intermediate  786 48.30% 30.00% 1.15% 20.48% NA
Temperate Japonica  767 20.10% 79.90% 0.00% 0.00% NA
Tropical Japonica  504 85.50% 2.20% 0.00% 12.30% NA
Japonica Intermediate  241 78.00% 21.60% 0.00% 0.41% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 62.20% 27.80% 1.11% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0141987444 T -> G LOC_Os01g72390.1 missense_variant ; p.Tyr403Ser; MODERATE nonsynonymous_codon ; Y403S Average:48.063; most accessible tissue: Minghui63 flower, score: 73.71 benign -0.333 TOLERATED 0.60
vg0141987444 T -> DEL LOC_Os01g72390.1 N frameshift_variant Average:48.063; most accessible tissue: Minghui63 flower, score: 73.71 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0141987444 NA 5.20E-06 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141987444 NA 1.92E-06 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141987444 NA 1.69E-06 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141987444 NA 2.39E-06 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141987444 NA 6.84E-07 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141987444 NA 1.94E-10 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141987444 NA 1.50E-07 mr1502 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141987444 NA 6.98E-06 mr1502 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141987444 NA 5.93E-06 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141987444 NA 7.54E-09 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141987444 NA 4.89E-07 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141987444 NA 3.90E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141987444 NA 7.07E-06 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141987444 NA 1.83E-06 mr1729 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141987444 NA 5.21E-06 mr1800 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141987444 NA 1.72E-06 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141987444 NA 2.15E-06 mr1892 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141987444 NA 1.76E-06 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141987444 NA 1.19E-07 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141987444 NA 5.23E-09 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141987444 NA 2.00E-06 mr1974_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251