Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0141987444:

Variant ID: vg0141987444 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 41987444
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:

CTGAGATGGTTGAGCACGCTTGGTGACCTGAAAGAAGCACCTTGAGACAAGTTCATCAAAAATCCAGGAACCCTTTGCTTCCAGATCCATAGCATCATCA[T/G]
ATGGGATCAGATCGTTAGCCATCCATAATTGAATTAACATATCCTTGTCTATCTTGTGAGTCCTTGGGAATAATGAACAAAAGGCGAAGCATCCTTTAAT

Reverse complement sequence

ATTAAAGGATGCTTCGCCTTTTGTTCATTATTCCCAAGGACTCACAAGATAGACAAGGATATGTTAATTCAATTATGGATGGCTAACGATCTGATCCCAT[A/C]
TGATGATGCTATGGATCTGGAAGCAAAGGGTTCCTGGATTTTTGATGAACTTGTCTCAAGGTGCTTCTTTCAGGTCACCAAGCGTGCTCAACCATCTCAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.80%	31.80%	0.53%	13.82%	NA
All Indica	2759	52.20%	25.90%	0.87%	21.02%	NA
All Japonica	1512	51.10%	44.70%	0.00%	4.17%	NA
Aus	269	67.30%	32.00%	0.00%	0.74%	NA
Indica I	595	28.10%	43.00%	0.84%	28.07%	NA
Indica II	465	78.30%	11.60%	0.86%	9.25%	NA
Indica III	913	58.10%	18.40%	0.66%	22.89%	NA
Indica Intermediate	786	48.30%	30.00%	1.15%	20.48%	NA
Temperate Japonica	767	20.10%	79.90%	0.00%	0.00%	NA
Tropical Japonica	504	85.50%	2.20%	0.00%	12.30%	NA
Japonica Intermediate	241	78.00%	21.60%	0.00%	0.41%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	62.20%	27.80%	1.11%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0141987444	T -> G	LOC_Os01g72390.1	missense_variant ; p.Tyr403Ser; MODERATE	nonsynonymous_codon ; Y403S	Average:48.063; most accessible tissue: Minghui63 flower, score: 73.71	benign	-0.333	TOLERATED	0.60
vg0141987444	T -> DEL	LOC_Os01g72390.1	N	frameshift_variant	Average:48.063; most accessible tissue: Minghui63 flower, score: 73.71	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0141987444	NA	5.20E-06	mr1029	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141987444	NA	1.92E-06	mr1031	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141987444	NA	1.69E-06	mr1063	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141987444	NA	2.39E-06	mr1170	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141987444	NA	6.84E-07	mr1291	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141987444	NA	1.94E-10	mr1486	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141987444	NA	1.50E-07	mr1502	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141987444	NA	6.98E-06	mr1502	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141987444	NA	5.93E-06	mr1530	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141987444	NA	7.54E-09	mr1543	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141987444	NA	4.89E-07	mr1543	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141987444	NA	3.90E-06	mr1625	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141987444	NA	7.07E-06	mr1629	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141987444	NA	1.83E-06	mr1729	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141987444	NA	5.21E-06	mr1800	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141987444	NA	1.72E-06	mr1815	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141987444	NA	2.15E-06	mr1892	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141987444	NA	1.76E-06	mr1974	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141987444	NA	1.19E-07	mr1502_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141987444	NA	5.23E-09	mr1543_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141987444	NA	2.00E-06	mr1974_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251