\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0141601194:

Variant ID: vg0141601194 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 41601194
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.02, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


GCGCCCCCCTAGAGCCAAAAACCGCCCTCTGTGAGGGCGGCAAATAGAGCTATCAAAAAAGCTCGAGGCTCGCGAGCTGCTCGAGCTCGACTCATCCTAG[G/A]
CTCGATTCGAGCTCGGGCTCGACCTCCAAACGAGCCGAGCCCGAGCCTGTCCCAAAGCTCACGAGCTTTGCGAGCCAAGCTCGAGCTTCTAACGAGCCTA

Reverse complement sequence

TAGGCTCGTTAGAAGCTCGAGCTTGGCTCGCAAAGCTCGTGAGCTTTGGGACAGGCTCGGGCTCGGCTCGTTTGGAGGTCGAGCCCGAGCTCGAATCGAG[C/T]
CTAGGATGAGTCGAGCTCGAGCAGCTCGCGAGCCTCGAGCTTTTTTGATAGCTCTATTTGCCGCCCTCACAGAGGGCGGTTTTTGGCTCTAGGGGGGCGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.70% 12.80% 14.11% 1.38% NA
All Indica  2759 53.10% 21.00% 23.60% 2.36% NA
All Japonica  1512 98.70% 1.10% 0.13% 0.00% NA
Aus  269 98.90% 0.40% 0.74% 0.00% NA
Indica I  595 68.60% 9.10% 22.02% 0.34% NA
Indica II  465 35.70% 30.50% 32.69% 1.08% NA
Indica III  913 47.50% 25.70% 21.14% 5.59% NA
Indica Intermediate  786 58.00% 18.80% 22.26% 0.89% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 96.80% 3.00% 0.20% 0.00% NA
Japonica Intermediate  241 99.20% 0.40% 0.41% 0.00% NA
VI/Aromatic  96 97.90% 0.00% 2.08% 0.00% NA
Intermediate  90 77.80% 11.10% 11.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0141601194 G -> A LOC_Os01g71820.1 upstream_gene_variant ; 2502.0bp to feature; MODIFIER silent_mutation Average:44.511; most accessible tissue: Minghui63 young leaf, score: 60.103 N N N N
vg0141601194 G -> A LOC_Os01g71830.1 upstream_gene_variant ; 2103.0bp to feature; MODIFIER silent_mutation Average:44.511; most accessible tissue: Minghui63 young leaf, score: 60.103 N N N N
vg0141601194 G -> A LOC_Os01g71840.1 upstream_gene_variant ; 4497.0bp to feature; MODIFIER silent_mutation Average:44.511; most accessible tissue: Minghui63 young leaf, score: 60.103 N N N N
vg0141601194 G -> A LOC_Os01g71820-LOC_Os01g71830 intergenic_region ; MODIFIER silent_mutation Average:44.511; most accessible tissue: Minghui63 young leaf, score: 60.103 N N N N
vg0141601194 G -> DEL N N silent_mutation Average:44.511; most accessible tissue: Minghui63 young leaf, score: 60.103 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0141601194 NA 2.16E-10 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141601194 NA 3.33E-06 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141601194 NA 1.08E-06 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141601194 NA 3.24E-07 mr1974 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141601194 NA 1.37E-09 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141601194 NA 9.51E-06 mr1984 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141601194 NA 3.59E-07 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141601194 NA 2.66E-06 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141601194 NA 2.74E-10 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141601194 NA 7.78E-06 mr1322_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141601194 NA 1.88E-09 mr1527_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141601194 NA 3.77E-06 mr1527_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141601194 NA 5.92E-07 mr1553_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141601194 NA 4.83E-07 mr1974_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141601194 NA 1.26E-06 mr1974_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251