\
| Variant ID: vg0141249435 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 41249435 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.09, others allele: 0.00, population size: 286. )
ATTTCATTTCATTAGTAGGTGCTCTTTAGATTTTTCCTTGAAATACTGGTTAAAATTCTAAGCAGTTTCTTTTGAGGCGCTTGTGTGTATTGCGCATAAC[A/G]
AACTTGTTTTCTTACATGTCAAGGTCAATCATCAACTTTTTCTATAACTTAGTATAACACATCTGTTTCAACCAGCAATGTATCTTTAACTCACTGTTTT
AAAACAGTGAGTTAAAGATACATTGCTGGTTGAAACAGATGTGTTATACTAAGTTATAGAAAAAGTTGATGATTGACCTTGACATGTAAGAAAACAAGTT[T/C]
GTTATGCGCAATACACACAAGCGCCTCAAAAGAAACTGCTTAGAATTTTAACCAGTATTTCAAGGAAAAATCTAAAGAGCACCTACTAATGAAATGAAAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.50% | 41.20% | 0.11% | 0.25% | NA |
| All Indica | 2759 | 82.20% | 17.30% | 0.07% | 0.36% | NA |
| All Japonica | 1512 | 5.70% | 94.10% | 0.20% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 75.80% | 23.50% | 0.17% | 0.50% | NA |
| Indica II | 465 | 89.50% | 9.90% | 0.00% | 0.65% | NA |
| Indica III | 913 | 88.80% | 11.10% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 75.20% | 24.30% | 0.00% | 0.51% | NA |
| Temperate Japonica | 767 | 1.40% | 98.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 7.10% | 92.30% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 16.20% | 83.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 52.20% | 45.60% | 0.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0141249435 | A -> G | LOC_Os01g71300.1 | upstream_gene_variant ; 1791.0bp to feature; MODIFIER | silent_mutation | Average:59.178; most accessible tissue: Callus, score: 86.833 | N | N | N | N |
| vg0141249435 | A -> G | LOC_Os01g71300.3 | upstream_gene_variant ; 1791.0bp to feature; MODIFIER | silent_mutation | Average:59.178; most accessible tissue: Callus, score: 86.833 | N | N | N | N |
| vg0141249435 | A -> G | LOC_Os01g71300.2 | upstream_gene_variant ; 1791.0bp to feature; MODIFIER | silent_mutation | Average:59.178; most accessible tissue: Callus, score: 86.833 | N | N | N | N |
| vg0141249435 | A -> G | LOC_Os01g71280.1 | intron_variant ; MODIFIER | silent_mutation | Average:59.178; most accessible tissue: Callus, score: 86.833 | N | N | N | N |
| vg0141249435 | A -> DEL | N | N | silent_mutation | Average:59.178; most accessible tissue: Callus, score: 86.833 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0141249435 | NA | 1.32E-06 | Spikelet_length | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0141249435 | NA | 1.31E-06 | mr1376 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141249435 | NA | 1.39E-06 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141249435 | NA | 1.31E-06 | mr1431 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141249435 | NA | 1.26E-06 | mr1532 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141249435 | NA | 9.74E-08 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141249435 | NA | 1.63E-06 | mr1528_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141249435 | NA | 3.60E-14 | mr1553_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141249435 | NA | 5.67E-06 | mr1671_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141249435 | NA | 3.21E-08 | mr1749_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141249435 | NA | 1.73E-07 | mr1821_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141249435 | NA | 1.32E-07 | mr1974_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141249435 | 4.51E-06 | 9.26E-08 | mr1974_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |