\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0141249435:

Variant ID: vg0141249435 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 41249435
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.09, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTCATTTCATTAGTAGGTGCTCTTTAGATTTTTCCTTGAAATACTGGTTAAAATTCTAAGCAGTTTCTTTTGAGGCGCTTGTGTGTATTGCGCATAAC[A/G]
AACTTGTTTTCTTACATGTCAAGGTCAATCATCAACTTTTTCTATAACTTAGTATAACACATCTGTTTCAACCAGCAATGTATCTTTAACTCACTGTTTT

Reverse complement sequence

AAAACAGTGAGTTAAAGATACATTGCTGGTTGAAACAGATGTGTTATACTAAGTTATAGAAAAAGTTGATGATTGACCTTGACATGTAAGAAAACAAGTT[T/C]
GTTATGCGCAATACACACAAGCGCCTCAAAAGAAACTGCTTAGAATTTTAACCAGTATTTCAAGGAAAAATCTAAAGAGCACCTACTAATGAAATGAAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.50% 41.20% 0.11% 0.25% NA
All Indica  2759 82.20% 17.30% 0.07% 0.36% NA
All Japonica  1512 5.70% 94.10% 0.20% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 75.80% 23.50% 0.17% 0.50% NA
Indica II  465 89.50% 9.90% 0.00% 0.65% NA
Indica III  913 88.80% 11.10% 0.11% 0.00% NA
Indica Intermediate  786 75.20% 24.30% 0.00% 0.51% NA
Temperate Japonica  767 1.40% 98.60% 0.00% 0.00% NA
Tropical Japonica  504 7.10% 92.30% 0.60% 0.00% NA
Japonica Intermediate  241 16.20% 83.80% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 52.20% 45.60% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0141249435 A -> G LOC_Os01g71300.1 upstream_gene_variant ; 1791.0bp to feature; MODIFIER silent_mutation Average:59.178; most accessible tissue: Callus, score: 86.833 N N N N
vg0141249435 A -> G LOC_Os01g71300.3 upstream_gene_variant ; 1791.0bp to feature; MODIFIER silent_mutation Average:59.178; most accessible tissue: Callus, score: 86.833 N N N N
vg0141249435 A -> G LOC_Os01g71300.2 upstream_gene_variant ; 1791.0bp to feature; MODIFIER silent_mutation Average:59.178; most accessible tissue: Callus, score: 86.833 N N N N
vg0141249435 A -> G LOC_Os01g71280.1 intron_variant ; MODIFIER silent_mutation Average:59.178; most accessible tissue: Callus, score: 86.833 N N N N
vg0141249435 A -> DEL N N silent_mutation Average:59.178; most accessible tissue: Callus, score: 86.833 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0141249435 NA 1.32E-06 Spikelet_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0141249435 NA 1.31E-06 mr1376 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141249435 NA 1.39E-06 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141249435 NA 1.31E-06 mr1431 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141249435 NA 1.26E-06 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141249435 NA 9.74E-08 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141249435 NA 1.63E-06 mr1528_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141249435 NA 3.60E-14 mr1553_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141249435 NA 5.67E-06 mr1671_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141249435 NA 3.21E-08 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141249435 NA 1.73E-07 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141249435 NA 1.32E-07 mr1974_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141249435 4.51E-06 9.26E-08 mr1974_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251